Spontaneous Malformation Is the answer
In DNA, which is located in the nucleus of the cell
Answer:
Trypanosoma brucei
Explanation:
T. brucei is a unicellular eukaryotic parasite that causes sleeping sickness. This organism has an elongated body, central nucleus, only an elongated mitochondria housing the kinetoplast, where the mitochondrial DNA is located; It has a scourge that gives it motility. Its undulating cell membrane, as a result of flagellar movements, is covered with glycoproteins that elicit little immune reaction, allowing this parasite to go unnoticed.
This organism infects the host by evading the host's immune system by altering its surface proteins with each generation.
The most serious type of accident which could occur at a nuclear power plant is <span>core meltdown caused by a failure of water to circulate among the fuel rods.
This is what happened in F.ukushima, Japan, in 2011, after a series of devastating earthquakes and tsunamis. This is why F.ukushima is still experiencing extremely high levels of radiation and parts of that area cannot be inhabited anymore.
</span>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
