1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arada [10]
2 years ago
9

If a particular protein is composed of 100 amino acids, how many nucleotide bases does it have?

Biology
2 answers:
Yuliya22 [10]2 years ago
6 0
150 cordons in amino acid
34kurt2 years ago
3 0

Answer:

150 codons

Explanation:

Explanation:

Each codon codes for a one amino acid.

Each codon requires three nucleic bases.

This is on a single strand of DNA or RNA.

Since DNA is a double helix it would require 900 nucleic bases on the DNA but only 450 nucleic bases for the RNA as the RNA is a single strand copy of the DNA.

A single mistake in the 150 codons or 900 DNA bases can result in a defective protein. For example cycle cell anemia is caused by the trading of an A for T on one codon.

150 codons might not seem like much but the amount of information stored in 150 codons is huge. ( 150 codons is actually small for a protein.)

You might be interested in
Which of the following best describes the hydrolysis of carbohydrates? a.The removal of a water molecule breaks bonds between su
In-s [12.5K]

Answer:

c.The addition of a water molecule breaks a bond between sugar mono-mers.

Explanation:

Hydrolysis refers to reaction with water. When water molecules are added to carbohydrates, the bonds between the sugar monomers are broken. This is the chemical reaction known as hydrolysis reaction.

Generally, since carbohydrates are polymers we can say that hydrolysis reactions result in the breakdown of carbohydrate polymers into sugar monomers by using water molecules

5 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
What is the function of phloem tissue in the plant transport system
seraphim [82]

Xylem moves water from roots to the leaves, and phloem moves food from the leaves to the rest of the plant. During transpiration water evaporates from the leaves and draws water from the roots.

Hope this helps , Danielle xo

3 0
3 years ago
Explain how the energy transfer to the wall and air would be different for ball 1
Darya [45]

Answer:

When a bouncing ball falls, it initially gains speed or kinetic energy—the energy of motion. When it reaches Earth, it collides head-on with an incredibly massive object that is, from your perspective, at rest. The ball slows down, deforms temporarily and shoots back up. The air in the ball acts like a spring—it gets compressed and expands again. During the collision, some of the ball's energy is converted into heat. As a consequence, the ball shoots up with less energy than it had when it reached Earth. Our planet, being so massive, does not move as a result of the collision.

Hope this helps...

7 0
2 years ago
What is the name of the process by which new oceanic lithosphere forms at mid ocean?
kondor19780726 [428]
Just guess bro it got me through life
8 0
3 years ago
Other questions:
  • Which of the following is true of embryonic stem cells but not of adult stem cells?
    5·2 answers
  • Which reflex requires gamma motor neurons to set the length of the muscle?
    6·1 answer
  • What are statements that are guaranteed to be true called?
    11·1 answer
  • Explain two ways your life was affected by bacteria today
    13·1 answer
  • What chromosomes have genes for the same traits in the same order on both chromosomes
    14·1 answer
  • Do most mutations generally cause the development of new traits found in organisms?
    13·2 answers
  • 2. Sketch the inside of the bean nodule, and describe or label what you observed with the hand lens.
    15·1 answer
  • The second generation of purebred cross of -hom-ozygo us recessive organism, with a —hom-ozygous dominant organism, contain a ra
    7·1 answer
  • What is a sickle cell?
    12·2 answers
  • PLSSS HELP IF YOU TURLY KNOW THISS
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!