1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lions [1.4K]
2 years ago
12

Chemosynthesis relies on chemical energy in the environment. The fact that no large organisms are known to undergo chemosynthesi

s suggests(1 point)
chemical energy in the environment is equal to light energy.


chemical energy in the environment is weaker than light energy.


chemical energy can never directly support large organisms.

chemical energy is toxic to large organisms.
Biology
1 answer:
Aleksandr-060686 [28]2 years ago
4 0

Answer:

The correct answer is chemical energy in the environment is weaker than light energy.

Explanation:

yw :)

You might be interested in
To survive hunter-gatherers changed their environment bya.Burning the prairies to prevent trees from growing.B.Spreading plants
Delvig [45]
The answer is c. both (a) and (b)
6 0
4 years ago
Which of the following correctly describes how the daughter cells produced during mitosis and meiosis compare to their parent ce
Leokris [45]
A, I’m pretty sure, Meiosis helps with genetic diversity
5 0
3 years ago
Read 2 more answers
The continents began to drift apart by the end of the
Eduardwww [97]
Continental drift happened around the Jurassic period, 175 million years ago.

<span />
3 0
3 years ago
Explain how a dead organism may become a fossil.
MrMuchimi
When the organism dies in a moist or wet area the organism gets covered in mud and the mud hardens like a rock. 
6 0
4 years ago
Read 2 more answers
What is one strand of a duplicated chromosome called?
Lady bird [3.3K]

Answer:

It is called a CHROMATID

5 0
4 years ago
Other questions:
  • Another name for hidden testes?
    11·1 answer
  • In a population of plants, the allele for long stems is completely dominant over the allele for short stems. If 35% of the popul
    15·1 answer
  • The phosphorus cycle differs from the carbon cycle in that: A. there is little or no human impact on the phosphorus cycle. B. ph
    10·1 answer
  • Fetal pig dissection lab analysis questions answer key
    7·1 answer
  • What is the importance of codons differing in the last nitrogenous base (ex. CUU, CUC both coding for leucine) but still being a
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which religious texts are associated with Judaism? Select the two correct answers
    12·2 answers
  • What are the effects of osmosis in general. Not just for plant cells. The first one to answer correctly gets marked brainliest a
    15·1 answer
  • Which of these changes occurs near the end of the third trimester of fetal
    9·1 answer
  • Which of the following processes is key to producing gametes?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!