1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
insens350 [35]
3 years ago
7

Which describes a disruption in the water cycle that could affect photosynthesis?

Biology
2 answers:
egoroff_w [7]3 years ago
6 0

The correct answer is option A

Disruption in the water cycle that can affect the rate of photosynthesis is loss of water from plants. The rise in temperature will increase the rate of loss of water.

Water is very important for the process of photosynthesis, as it is the electron donor in this process.

If there will be more loss of water due to transpiration in high temperature, then the rate of photosynthesis will decrease.

belka [17]3 years ago
4 0

The right answer is Transpiration.

In plants, plant transpiration is the continuous process caused by the evaporation of water from the leaves (and the corresponding recovery from the roots in the soil).


For large plants and helophytes, it can be very important. On average, a plant loses the equivalent of its weight in water per day. This explains the role played by large plant formations, including forests on the water cycle and climate.


You might be interested in
PLEASE ANSWER FAST
olasank [31]

Answer:

D. Sensory Neuron

Explanation:

Sensory neurons are the nerve cells that are activated by sensory input from the environment.

4 0
3 years ago
Read 2 more answers
Indicate whether each of the following descriptions is true of microtubules (MT), microfilaments (MF), intermediate filaments (I
qwelly [4]

Answer:

(a) Microfilaments

(b) Microtubules

(c) Microtubules

(d) Microfilaments

(e) Intermediate filaments

(f) Microfilaments, intermediate filaments, microtubules

(g) Microfilaments, microtubules

(h) Microfilaments, intermediate filaments, microtubules

(i) Microtubules, microfilaments

(j) Microtubules

Explanation:

Microtubules (MTs) are dimers of the protein tubulin (alpha- and beta-tubulin subunits) and they are major components of the cytoskeleton. MTs play diverse cellular roles including, mechanical support (cytoskeleton), transport, motility, chromosome segregation, etc. Microfilaments (MFs) are protein filaments that also form part of the cytoskeleton in eukaryotic cells. MFs consist of G-actin monomers assembled in linear actin polymers, and their functions include mechanical support, cytokinesis, changes in cell shape, amoeboid movement, endocytosis and exocytosis, etc. MFs associate with the protein myosin to generate muscle contractions. Actin filaments/MTs assembly from monomeric actin/tubulin is caused due to energy expenditure, where ATP/GTP bound to actin/tubulin is hydrolyzed during polymerization. Finally, intermediate filaments (IFs) are a type of cytoskeletal element composed of a heterogeneous group of structural elements, and they are not found in all eukaryotes. The primary function of the IFs is to contribute to the mechanical support for the plasma membrane where these filaments come into contact with other cells and/or with the extracellular matrix. The IFs are not directly involved in cell movement. All 3 types of cytoskeletal elements (microfilaments, intermediate filaments, microtubules) can be visualized by fluorescence microscopy when cells express chimeric MT/IF/MF.–GFP fusion proteins.

8 0
3 years ago
Which of the following represents the correct order of events? a) Food → Krebs cycle → Glycolysis → Fermentation b) Food → Glyco
iogann1982 [59]

Answer:

The correct answer is b) Food → Glycolysis → Krebs cycle → Electron transport chain.

Explanation:

When food enters the organism it goes through a lot of processes to become the beginning of glycolysis which produces pyruvate, which turns into acetyl CoA, which at the same time is the beginning material of Krebs cycle. The products of this cycle provide energy for the electron transport chain (NAD(H) and FAD(H)).

3 0
3 years ago
Read 2 more answers
Epithelial tissue always has an exposed outer surface and an inner surface anchored to connective tissue by a thin, non- cellula
Rashid [163]

The basement membrane is the thin, non-cellular structure of connective tissue that separates the lining of an internal surface and external surface from underlying connective tissue in metazoans.

The epithelium is a type of body tissue that covers all internal and exterior body surfaces, lines hollow organs and body cavities, and makes up most of the glandular tissue. The body comprises four types of tissues; depending on the location, connectives, muscular, nervous, and Epithelial, which perform the function of protection, secretion, and absorption.

Some examples of epithelial tissues in your body are the outer layer of the skin called the epidermis, the sweat glands, respiratory tract lining, intestines lining, etc. you can also read more on Epithelial tissue.

Learn more about Epithelial tissue here:

brainly.com/question/28391303

#SPJ4

4 0
1 year ago
How do scientist collect data?
PolarNik [594]

Answer:

1. Define a Question to Investigate

As scientists conduct their research, they make observations and collect data. The observations and data often lead them to ask why something is the way it is. Scientists pursue answers to these questions in order to continue with their research. Once scientists have a good question to investigate, they begin to think of ways to answer it.

2. Make Predictions

Based on their research and observations, scientists will often come up with a hypothesis. A hypothesis is a possible answer to a question. It is based on: their own observations, existing theories, and information they gather from other sources. Scientists use their hypothesis to make a prediction, a testable statement that describes what they think the outcome of an investigation will be.

3. Gather Data

Evidence is needed to test the prediction. There are several strategies for collecting evidence, or data. Scientists can gather their data by observing the natural world, performing an experiment in a laboratory, or by running a model. Scientists decide what strategy to use, often combining strategies. Then they plan a procedure and gather their data. They make sure the procedure can be repeated, so that other scientists can evaluate their findings.

4. Analyze the Data

Scientists organize their data in tables, graphs, or diagrams. If possible, they include relevant data from other sources. They look for patterns that show connections between important variables in the hypothesis they are testing.

5. Draw Conclusions

Based on whether or not their prediction came true, scientists can then decide whether the evidence clearly supports or does not support the hypothesis. If the results are not clear, they must rethink their procedure. If the results are clear, scientists write up their fi ndings and results to share with others. The conclusions they draw usually lead to new questions to pursue.

5 0
3 years ago
Other questions:
  • Identify the three main stages of translation
    12·2 answers
  • Explain how sustainability is dependent on the ecological footprint
    14·1 answer
  • Suppose a one-year old child is playing with a toy near an electrical out-let. He sticks part of the toy into the outlet. He get
    9·2 answers
  • Place in correct order the following steps in the process of appositional growth of cartilage. a: New matrix is produced and sec
    13·1 answer
  • The lipid components of cellular membranes often include:
    13·2 answers
  • Why might it be important to the survival of a species that mutations to dna cause changes in organisms?
    14·1 answer
  • Trứng có trước hay con gà có trước ?
    8·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • A man is at high risk for having a heart attack, the offspring will face risks as well.this is an example of.
    13·1 answer
  • How does the bacterial chromosome differ from the chromosomes found in eukaryotes
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!