1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
2 years ago
13

What is vertebral column?​

Biology
2 answers:
Alexandra [31]2 years ago
7 0

(ver-TEE-brul KAH-lum) The bones, muscles, tendons, and other tissues that reach from the base of the skull to the tailbone. The vertebral column encloses the spinal cord and the fluid surrounding the spinal cord. Also called backbone, spinal column, and spine. Enlarge

chubhunter [2.5K]2 years ago
6 0
the central axis of the skeleton in all vertebrates. That’s for health but tell me if that’s the wrong answer
You might be interested in
Where does the energy of living things ultimately come from? And how? Explain the transformation
Reil [10]

Answer:

It all comes from the sun

Explanation:

this is because without the sun plants wouldn't grow and without plants our meat sources can't eat and therefore nothing else can either.

8 0
3 years ago
On average, adolescents need how many hours of sleep each night for proper growth and brain development?
Anestetic [448]
The answer would be D, 7 hours of sleep
7 0
3 years ago
Blood enters the pulmonary vein with close blank of the blinding site for oxygen saturated
vovangra [49]
Blood enters the pulmonary vein with close to 100% of the blinding site for oxygen saturated.
7 0
3 years ago
2.4 State two reasons why the fern plants are able to
crimeas [40]

Answer:

Explanation:

This is because ferns are vascular plants i.e they have vascular tissues which are xylem and phloems which help to conduct water and nutrients while mosses are non vascular plants.

2. Ferns sporophytes are differentiated into true leaves, stems and true roots while mosses lack true roots, stems and leaves.

Underground stems are modified part of plants that are derived from stem tissues which grow under the ground. Underground stems grow beneath the soil. Examples include Rhizomes, ginger, tubers e t.c.

5 0
2 years ago
Addresses do not change if you copy them to a different cell.
REY [17]

addresses change depending on the cells you copy to them

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following are not part of nonspecific defenses against infection?
    5·1 answer
  • Which statement explains How smog forms​
    10·2 answers
  • What senses, outside of hearing, would likely be impaired if a person were somehow missing all of the apparatus of the ear (incl
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Does ocean water take longer to freeze than freshwater
    9·1 answer
  • A hockey puck with a mass of 0.16 kg is sitting at rest on a frozen pond. Suddenly, the wind begins to blow, accelerating the pu
    9·2 answers
  • I need help FAST!! U have too match the letters with the #.!
    9·1 answer
  • Find out which animal is actually most closely related to the hawk: shark, bat, or alligator. Report your findings and explanati
    10·2 answers
  • Which of the following molecules do NOT break down Proteins?
    9·2 answers
  • What are the chances that the mother and father will have a baby with no freckles? _____ out of 4, or ______ %?​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!