1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ikadub [295]
2 years ago
6

What is a

Biology
1 answer:
Gekata [30.6K]2 years ago
5 0
A. Animal with 4 stomachs
You might be interested in
Gerard lives in a tropical region where the average
Inga [223]
It’s Insulated gloves because you wouldn’t need gloves in 77 degree weather.
7 0
3 years ago
During the process of photosynthesis,
TEA [102]

Answer:

d. less than 100% of the energy captured from sunlight is transformed into potential energy in the form of a hydrogen ion gradient and then into potential energy in the form of covalent bonds

Explanation:

Photosynthesis is process utilized by plants, several bacteria and protists to convert the light energy to chemical energy. So they utilize the photosynthesis as the powerhouse for the energy production. Heterotrophs like human that cannot synthesize their own food, use this converted form of energy by autotrophs.

During the light reaction of photosynthesis the photons from light are absorbed by photosystem I and II. These photons excites the electrons which flow through the electron transport chain from higher potential to lower potential. These electrons release the energy while moving from higher potential to lower potential which is utilized by H+ pump to pump the H+ to lumen of plastids from stroma and of course not the 100% energy is utilized some of the energy dissipates. . So this process causes the accumulation of high potential H+ ions across the membrane. These H+ ions are utilized for the production of ATP by ATP synthase complex when they flow back to lower potential across the membrane through ATP synthase complex.

The ATP and NADPH produced from light reaction are utilized to combine carbon molecules during dark reaction. The covalent bond is used to combine the carbon molecules and we know that combining carbon molecules stores energy in the form of covalent bond.

8 0
3 years ago
Read 2 more answers
WILL MAKE BRAINLIEST
Dmitry [639]

Answer:

it is evolution

hope it helps

6 0
3 years ago
Read 2 more answers
Which molecule is a product of respiration?
ivann1987 [24]

Explanation:

A. carbon dioxide

simple

4 0
3 years ago
The committee that advises the Fed on the growth of the money supply and the level of interest rates is the
il63 [147K]
The committee that advised the Fed on the growth of the money supply and the level of interest rates is "B", the Federal Open Market Committee. 
<span>The Federal Open Market Committee is the branch of the Federal Reserve Board that determines USA monetary policy. It consists of twelve members and holds eight meetings a year. The committee reviews current economic and financial conditions to plot the way forward for the Federal monetary policy. It also assesses the risks to its long-term goals of price stability and sustainable economic growth.</span>
7 0
4 years ago
Other questions:
  • Why is sex imperative to evolution?
    14·2 answers
  • Marathon runners typically will eat foods high in carbs 2-3 days before they run the race. This allows them to have large stores
    10·1 answer
  • Catalase is an enzyme that is found in all living tissues. Cells need catalase in order to function properly. Which of the follo
    6·2 answers
  • Amino acids are the subunits of larger molecules called
    15·1 answer
  • All animals
    5·1 answer
  • The dna of humans and mice is almost 92% Similar . This similarity indicates that . Nice have a tail , while humans have a tailb
    9·2 answers
  • All plants and some algae have a complicated life cycle that includes both a multicellular diploid _______ stage and a multicell
    12·1 answer
  • What molecule in the equation is a hydrcarbon?
    14·1 answer
  • Could receiving extra chromosomes happen to the tasmanian devil? Why or why not?
    15·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!