1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex17521 [72]
2 years ago
10

Combining amino acids into a polypeptide Anabolic Catabolic

Biology
2 answers:
Evgen [1.6K]2 years ago
8 0

Explanation:

anabolic is the answer

because a large molecule is made from smaller ones.

ziro4ka [17]2 years ago
7 0

Anabolic combines amino acids into a polypeptide.

You might be interested in
The following is a list of the vessels that blood passes through from the heart back to the heart.The correct order in which blo
slamgirl [31]

Answer:

elastic arteries, muscular artery, arterioles, capillary, venules, medium veins, large veins,

Explanation:

There are three types of blood vessels a) arteries b) capillaries and c) Veins. Arteries are responsible for carrying blood from heart to all other parts of the body. The arteries arising from heart are large in size which then keep on branching and becoming small enough for cellular exchange.  

Capillaries are intermediary to veins and the arteries as they allow exchange of nutrient and release of waste product to and from from cells.  

Lastly, veins carry deoxygenated blood from organs to the heart. Vieins become larger in size as they get close to heart.  

Hence, the correct order is  

elastic arteries, muscular artery, arterioles, capillary, venules, medium veins, large veins,

5 0
4 years ago
How do the diaphragm and rib muscles help with breathing? These muscles
Ratling [72]
When you breathe in, or inhale, your diaphragm contracts and moves downward. This increases the space in your chest cavity, and your lungs expand into it. The muscles between your ribs also help enlarge the chest cavity. They contract to pull your rib cage both upward and outward when you inhale
3 0
3 years ago
Which organelle has large storage containers for water, food, and waste only in plant cells
Tamiku [17]

Answer:

Vacuole

Explanation:

The vacuole is one of the largest organelles in a plant cell because it holds the water, food, and waste of the cell.

4 0
3 years ago
Read 2 more answers
_____________ is a post replication dna repair pathway that provides backup to replicative proofreading.
belka [17]
<span>Mismatch repair is a postreplication DNA repair pathway that provides backup to replicative proofreading.</span>
5 0
3 years ago
The question is on the picture .
lord [1]

Answer:

"C. Two tectonic plates moving away from one another."

Explanation:

Mid-ocean ridges are formed when seafloor spreading occurs among a divergent plate boundary.

6 0
3 years ago
Read 2 more answers
Other questions:
  • During which stage of the general adaptation syndrome does the body no longer function normally due to chronic activation of the
    9·1 answer
  • Water that contains 2 mg oxygen per liter or less is termed hypoxic, since at that concentration many aquatic aerobic organisms
    15·1 answer
  • What is the next step in the process after a substrate enters the active site of an enzyme?
    7·1 answer
  • Walter conducts an experiment with pea plants. He crosses two hybrids (Yy). If the cross produces 100 offspring, how many will b
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Much help would be appreciated!!<br>Give an explanation of Phagocytosis.<br>​
    9·1 answer
  • What is the term for a female reproductive cell?
    15·1 answer
  • Which molecule reads the amino acid sequence and builds the protein?​
    9·2 answers
  • Give An example of how a structure is related to function in living things
    6·1 answer
  • In the spring, Florida plants respond to ________.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!