The doctor should check B) The amount of sodium intake the patient takes daily.
Eating salt raises the amount of sodium in your bloodstream and wrecks the delicate balance, reducing the ability of your kidneys to remove the water. The result is a higher blood pressure due to the extra fluid and extra strain on the delicate blood vessels leading to the kidneys. Adding higher blood pressure to an already hbp patient wouldn't have good results.
Hope this helps.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Temporal isolation , behavioral isolation, and geographical isolation I hope I answered your question if not please try searching up or using further sources
Answer:
The correct answer will be option-B.
Explanation:
<em>Homo neanderthelensis</em> or Neanderthals are the close relatives of the <em>Homo sapiens</em> or modern humans which became extinct around 10,000 years ago.
The Neanderthals and sapiens are the two related species of the same genus Homo but they showed distinct features like Neanderthals were muscular and shorter in height compared to the <em>Homo sapiens</em>. Recent fossils indicated that Neanderthals and<em> Homo sapiens</em> interbreed in some parts of the world as they were closely related to each other.
Thus, Option-B is the correct answer.
