1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kkurt [141]
2 years ago
8

What happens to the muscles of people with marfan syndrome

Biology
2 answers:
Alexeev081 [22]2 years ago
6 0

Answer:

Muscle fatigue is often reported by patients with Marfan syndrome although myopathy is not classically considered a component of Marfan syndrome [1, 2, 4, 6, 7]. In addition to apparent muscle underdevelopment, some patients report myalgia or cramps suggesting skeletal muscle involvement.

Explanation:

Stella [2.4K]2 years ago
3 0

Answer:

Muscle fatigue is often reported by patients with Marfan syndrome although myopathy is not classically considered a component of Marfan syndrome [1, 2, 4, 6, 7]. In addition to apparent muscle underdevelopment, some patients report myalgia or cramps suggesting skeletal muscle involvement.

You might be interested in
Can someone please help me giving brainliest ​
sweet [91]

Answer:

B. Getting energy from sunshine.

Explanation:

having sunshine is very important because it is good for you and your body.

one time I was sick and I stayed inside all the time and my parents made me go outside because of fresh air and the sun, and I felt better the next day, I could actually get up and do something.

7 0
3 years ago
Which system within the human body serves primarily to<br> protect the body from disease?
ss7ja [257]

Answer:

skin it protects from germs

4 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Name the two different types of translatory motion and explain each in brief​
garik1379 [7]
Translatory motion can be of two types: rectilinear and curvilinear. If a body moves as a whole such that every part of the body moves through the same distance in a given time, then the body is said to be in translatory motion.
5 0
2 years ago
Suppose the human trait for freckles is controlled by a simple dominant and recessive relationship at one locus. Freckles, F, is
Dennis_Churaev [7]

Answer:

0.549 is the frequency of the F allele.

0.495 is the frequency of the Ff genotype.

Explanation:

<em>FF </em>or <em>Ff</em> genotypes determine freckles, <em>ff</em> determines lack of freckels.

In this class of 123 students, 98 have freckles (and 123-98= 25 do not).

If the class is in Hardy-Weinberg equilibrium for this trait, then the genotypic frequency of the ff genotype is:

q²= 25/123

q²=0.203

q= \sqrt{0.2

q= 0.451

<em>q </em>is the frequency of the recessive f allele.

Given <em>p</em> the frequency of the dominant F allele, we know that:

p+q=1, therefore p=1-q

p=0.549 is the frequency of the F allele.

The frequency of the Ff genotype is 2pq. Therefore:

2pq=2×0.549×0.451

2pq=0.495 is the frequency of the Ff genotype.

5 0
3 years ago
Other questions:
  • A mixture in which the suspended particles are too small to be seen with the naked eye is a _____. suspension
    9·2 answers
  • What a makes butterfly so special?
    15·2 answers
  • What evolutionary milestone made it possible for more complex, multicellular organisms to exist?
    13·1 answer
  • What is the difference between newtons laws of motion and i steins theory of relativity
    6·1 answer
  • Which represents a deletion of a section of the DNA shown here?
    13·1 answer
  • Why are black bears not found in groups?
    10·2 answers
  • BRAINLIESTTT ASAP!!!<br><br> Give a detailed description of a dafofill flower.
    8·1 answer
  • Which of the following is needed for cellular respiration?
    10·1 answer
  • A mother is feeding her infant a cultural dish that contains honey. How do you manage this situation in a culturally sensitive w
    6·1 answer
  • A researcher studying lobsters notices that there are distinctly different populations found in certain areas of their distribut
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!