All categories

2 years ago

What happens to the muscles of people with marfan syndrome

Biology

2 answers:

Alexeev081 [22]2 years ago

6 0

Answer:

Muscle fatigue is often reported by patients with Marfan syndrome although myopathy is not classically considered a component of Marfan syndrome [1, 2, 4, 6, 7]. In addition to apparent muscle underdevelopment, some patients report myalgia or cramps suggesting skeletal muscle involvement.

Explanation:

Stella [2.4K]2 years ago

3 0

Answer:

You might be interested in

Can someone please help me giving brainliest

sweet [91]

Answer:

B. Getting energy from sunshine.

Explanation:

having sunshine is very important because it is good for you and your body.

one time I was sick and I stayed inside all the time and my parents made me go outside because of fresh air and the sun, and I felt better the next day, I could actually get up and do something.

7 0

3 years ago

Which system within the human body serves primarily to protect the body from disease?

ss7ja [257]

Answer:

skin it protects from germs

4 0

3 years ago

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0

2 years ago

Name the two different types of translatory motion and explain each in brief

garik1379 [7]

Translatory motion can be of two types: rectilinear and curvilinear. If a body moves as a whole such that every part of the body moves through the same distance in a given time, then the body is said to be in translatory motion.

5 0

2 years ago

Suppose the human trait for freckles is controlled by a simple dominant and recessive relationship at one locus. Freckles, F, is

Dennis_Churaev [7]

Answer:

0.549 is the frequency of the F allele.

0.495 is the frequency of the Ff genotype.

Explanation:

FF or Ff genotypes determine freckles, ff determines lack of freckels.

In this class of 123 students, 98 have freckles (and 123-98= 25 do not).

If the class is in Hardy-Weinberg equilibrium for this trait, then the genotypic frequency of the ff genotype is:

q²= 25/123

q²=0.203

q= $\sqrt{0.2$

q= 0.451

q is the frequency of the recessive f allele.

Given p the frequency of the dominant F allele, we know that:

p+q=1, therefore p=1-q

p=0.549 is the frequency of the F allele.

The frequency of the Ff genotype is 2pq. Therefore:

2pq=2×0.549×0.451

2pq=0.495 is the frequency of the Ff genotype.

5 0

3 years ago