A photograph of all the stained, prepared chromosomes in a eukaryotic cell is referred to as a karyotype
Dominant gene. <span>A dominant gene produces a dominant phenotype in individuals who have one copy of the allele, and it could come from one parent </span>
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Meat from other animals. It doesn't say any specific type of animals, but it said that they would eat animals larger than themselves by tearing the flesh with their sharp beaks. They would not shake the prey from side to side, but rather slam it on the ground.
