1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Usimov [2.4K]
2 years ago
8

The condition in which there are barriers to successful interbreeding between individuals of different species in the same commu

nity is referred to as.
Biology
1 answer:
Darya [45]2 years ago
8 0
Reproductive isolation

further information: the condition in which there are barriers to successful interbreeding between individuals of different species in the same community. phylogenies. evolutionary trees that evaluate which groups of organisms may be closely related to one another.
You might be interested in
Is an aphid a producer
Umnica [9.8K]
No, producers produce their own food like plants that use photosynthesis to produce sugar whilst aphids cannot produce their own food and have to feed of other plants.
5 0
4 years ago
What people need in order to be happy is the concern working in which field? A.Social cognitive B.Humanistic or positive C.Biops
yarga [219]
I believe the answer is D, because you will need to have a positive attitude dealing with peoples diffrent behavioral issues

4 0
3 years ago
Some organisms, like lizards who bask in the sun, use ____________ to help regulate their ____________ environment.
dolphi86 [110]

Answer:

location, internal

7 0
3 years ago
What does each phase of mitosis look like.
mr Goodwill [35]

Answer:

Bruh. What the dude said upctopcis correct ^^

Explanation:

5 0
3 years ago
Summarize the four steps to natural selection
Anna11 [10]

Overproduction - An organism gives birth to too many children

Genetic Variation - The offspring each have genetic differences in appearance, behavior, etc

Struggle to Survive - Offspring must fight in order to gain essential resources (food, water, mates, etc)

Successful Reproduction - Organism produces offspring with beneficial adaptations that aid in survival

5 0
3 years ago
Other questions:
  • A single occupancy padded cell for the temporary holding of inmates harmful to themselves and or others is a ____?
    14·1 answer
  • Give one example of how cooperation can help organisms survive
    12·1 answer
  • The bony, spiral-shaped, fluid-filled sense organ used for hearing is the __________.
    14·1 answer
  • When two ova are released and both are fertilized by a sperm, what type of twins result?​?
    14·1 answer
  • What types of nitrogen are plants easily able to use
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • When seeing her preterm infant in the neonatal intensive care unit for the first time, a mother exclaims, "my baby is so little!
    5·1 answer
  • HELP PLZZZZZZZZZZZZZZZZ
    9·1 answer
  • What type of organisms contains plasmid DNA
    15·2 answers
  • What is released as a byproduct of photosynthesis ​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!