Answer: cytokinesis
Explanation:
In animal cells, cytokinesis is achieved when a contractile ring of the cell microtubules form a cleavage furrow that divides the cell membrane into half.
Answer:
hi how r u are u fine i am fine an u hehehe
The lateral line system provides tactile sense organs ( that is from cyclostome fishes to amphibians or the aquatic vertebrates) with a sense of distant touch, enabling these animals to sense objects that reflect pressure waves and low-frequency vibration. This system made up of multiple of neuromasts.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
In fact, adding salt does<span> the very opposite of </span>making<span> water </span>boil faster. Instead, itmakes<span> it take longer for the water to </span>boil<span>! The </span>salt<span> actually increases the boiling point of the water, which is when the tendency for the water to evaporate is greater than the tendency for it to remain a liquid on a molecular level.</span>
