1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marizza181 [45]
2 years ago
12

Source: https://www.

Biology
1 answer:
Ghella [55]2 years ago
4 0
C is the correct answer
You might be interested in
The two main classes of angiosperms are _____. xylem and phloem monocots and dicots raceme and umbel pistil and stamen
Lemur [1.5K]
They are monocotyledons and dicotyledons.
the angiosperms can be divided in two categories.
i hope that helps.
4 0
3 years ago
Read 2 more answers
What are the characteristics of a multi celled organism
vlabodo [156]

Answer:

Multicellular organisms are made of more than one cell and are complex organisms.

They are visible to the naked eye.

They possess distinct organs and organ systems.

They are eukaryotes, i.e., they contain membrane-bound structures.

Their cells exhibit division of labor.

Their size increases with the number of cells in an organism

Explanation:

4 0
3 years ago
Humans are unique in that they have adapted to the natural environment through a series of long-term interactions between ____.
pav-90 [236]
The gene pool. This is the series and combinations of genes in the environment. This can affect the human adaption of the environment and how they cope up with the species living with them. They interact with them in a way that the species can affect one another,
6 0
4 years ago
Terminal bronchioles, part of the conducting zone, give rise to respiratory bronchioles, which are part of the respiratory zone.
Svetradugi [14.3K]
B.false
Respiratory bronchioles or terminal bronchioles are also part of the conducting zone.
6 0
4 years ago
All animals are _______. a. producers b. omnivores c. herbivores d. consumers
vladimir1956 [14]

The right option is; d. consumers

All animals are consumers

Consumers are organisms that usually feed on other organisms or organic matter in order to gain energy because of their inability to manufacture their food from inorganic sources. All animals are consumers and they are also known as heterotrophs. There are different types of consumers. They include; primary consumers (herbivores e.g. goats, cows), secondary consumers (carnivores e.g. wolves, crocodile), and tertiary consumers (large carnivores e.g. eagle, lion)


3 0
3 years ago
Read 2 more answers
Other questions:
  • What are some things that are not composed of cells
    14·1 answer
  • A gene that masks the expression of a second gene is
    6·1 answer
  • How are the 3 stages of cell division similar to how new animals are created?
    5·1 answer
  • Dr. blackwell caused rats to stop breathing when he lesioned their _____.
    6·1 answer
  • What colors can a turtle see
    13·1 answer
  • Question 7
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Why would an enginner not chooese material such as concrete when designing an earthquake proof
    14·1 answer
  • Is interphase before or after mitosis?
    8·1 answer
  • 17. The mass of the products of a chemical reaction the mass of the reactants.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!