Mutation rate of Gram negative bacteria is much greater than that of Gram positive bacteria.
Explanation:
The gram positive types of bacteria responsible for causing diseases in humans. It is called as Gram positive bacteria. Both the bacteria are different in structural and physical properties. It is defined as the group of bacteria’s which positive result in gram stain test.
Gram negative bacteria are the group of bacteria’s which gives negative result to the gram stain test. This classification is done according to the cell wall. The cause of common disease by Gram positive bacteria is our anthrax, diphtheria, etc.
An organ is the biggest out of all of these. Organs are formed from groups of tissues and tissues are groups of cells. A molecule is one of the small holes you see your hair grow out from.
Answer: "homeostasis" .
_________________________________________________
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
