1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uranmaximum [27]
2 years ago
6

Need it now 100 points

Biology
2 answers:
Phoenix [80]2 years ago
8 0

Answer:

I think the answer is D

Explanation:

iogann1982 [59]2 years ago
4 0

Answer:

The answer is D, An island farther from the mainland

Explanation:

You might be interested in
What of the following organisms is located only in the 3rd trophic level of the soil food chain?
iren [92.7K]
I think your answer is C. Protozoa
6 0
3 years ago
Read 2 more answers
What forms when platelets seal a break in the vessel wall?
Allisa [31]

Answer:

A blood clot

Explanation:

It is formed to stop bleeding and foreign bodies from entering the body.

6 0
3 years ago
Which of the following is the place where proteins are made<br>​
GenaCL600 [577]
Proteins are made inside cells. When a cell makes a protein it is called protein synthesis.
4 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which of the following is not a metamorphic agent? <br>​
Gre4nikov [31]

Answer:

the following is not a Metamorphic agent is lithification

3 0
3 years ago
Other questions:
  • Which biome has the highest diversity of species?
    14·2 answers
  • Describe how oxygen gas (O2) is produced during photosynthesis. Include the specific structures in the plant where the reaction
    5·1 answer
  • Which step begins the process of translation?
    12·2 answers
  • As plants grow, stems and branches thicken or increase in girth. This thickening is a result of cells in the vascular cambium. V
    8·2 answers
  • Use the terms below to complete the sequence of the levels of organization in the multicellular organism
    12·1 answer
  • A behavior modification strategy for weight loss is to avoid feelings of deprivation by consuming small meals and snacks through
    8·1 answer
  • The two sources of new materials involved in geologic processes are
    9·2 answers
  • 3. Psychologists like to experiment on other organisms in their immediate environment, so Jenny
    6·1 answer
  • List all structures of an animal cell
    5·1 answer
  • How does nectar increase the ability of plants to reproduce?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!