1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Savatey [412]
2 years ago
10

ASAP!! I am doing combined science higher can someone help me please

Biology
1 answer:
Juliette [100K]2 years ago
5 0

Blood flow to the exercising muscles of the brachium and thigh increased by 31- to 38-fold during moderate exercise and by 70- to 76-fold during severe exercise.

You might be interested in
19
siniylev [52]

Answer: your answer is between c and b

Explanation:

5 0
3 years ago
How much water does the average american family for four users use per day in their home?
aliina [53]
The average american family uses 400 gallons of water per day in there homes........(GOODLUCK!)
4 0
3 years ago
Which structures are found in plant cells, but not in animal cells? Check all that apply. Cell wall cell membrane chloroplasts l
Brilliant_brown [7]

The answers would be

Cell Wall

and

Chloroplasts

4 0
3 years ago
Read 2 more answers
A student runs a simulation of resource consumption in which cereal is used to model a resource. the student spends 15 seconds u
NemiM [27]
C. Rate of harvesting
8 0
3 years ago
Read 2 more answers
A couple has two children, both of whom are boys. Show the following cross between a
hammer [34]

Answer:

um 50%

Explanation:

5 0
3 years ago
Other questions:
  • The absolute magnitude of a star:
    6·2 answers
  • Evergreens are plants that maintain their leaves in all seasons and include trees such as____,____, and____.
    8·1 answer
  • A primate species with a brain size of 1200 cc is discovered. mc010-1.jpg From the information in the graph, what can be predict
    14·2 answers
  • 9.
    10·2 answers
  • I’m really confused lol I need help
    12·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • PLESEEEEE
    15·1 answer
  • A patient named Roberto is grieving because he noticed that the money he has saved all his life is not going to his family but i
    13·1 answer
  • Which of the following is one of the most rapid ways of determining the general characteristics of a specimen? O Biochemical tes
    13·1 answer
  • A bean plant produces a seed
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!