Answer:
1. metagenomics_the study of all of the genetic material of all organisms in a particular habitat.
2. transcriptomics_the study of all of the RNA produced by an organism.
3. proteomics_the study of all of the proteins produced by an organism.
4. metabolomic_the study of all intermediates and small molecules produced by reactions within an organism.
5. genomics_the study of the entire genetic makeup of an organism.
Explanation:
Pregunta completa: un caballo negro de antepasados desconocidos fue apareado con cierto numero de yeguas de color rojo de raza pura, estos apareamientos dieron 20 descendientes de colo rojo y 25 de color negros.
A) cual de dichos caracteres fenotipicos es mas probable que este causado por un homocigoto recesivo?
B) segun su hipotesis cuantos individuos de cada clase habrian esperado
Answer:
A) El color rojo es causado por un genotipo homocigota recesivo
B) Se habrían esperado 22.5 individuos negros y 22.5 individuos rojos, que juntos sumarian un total de 45 individuos.
Explanation:
El desarrollo del problema se encuentra disponible en el archivo adjunto
Answer:
it means They have been tampered with by chemicals steroids its science that makes foods bigger and tastes better.
Explanation:
they take the things that make the food and put all types of things in them to make then tastes better like apples they modify those to make them bigger and juicier.
Answer:
Retinoblastoma is more common in people due to the mutation of RB gene in them.
Explanation:
Retinoblastoma is a disease that affects the eyes of an individual. It is more commonly eye cancer which occurs on the retina of the eye. Retinoblastoma mainly affects younger children.
When the RB gene is mutated or it is deleted already on any one of a homologous chromosomes, then only one hit rather that two which is needed to cause the development of retinoblastoma and hence the probability is of retinoblastoma to occur is higher in the individuals who have already inherited the RB deletion and also have a genetic predisposition for the retinoblastoma.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
