1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
2 years ago
8

Which animal phylum was the first to develop a dorsal nerve cord a backbone?

Biology
1 answer:
VLD [36.1K]2 years ago
4 0

Answer:

Chordates?

Explanation:

You might be interested in
What do you think will be the biggest<br> space mission of the twenty-first century?
pav-90 [236]

Answer:

going to all the other plants to try to find life form

7 0
4 years ago
Most stars end their lives as which type of star?
mestny [16]
A white dwarf is the answer
6 0
4 years ago
How do protists, fungi, or plants potentially benefit or harm us? You should be able to find a pro and a con for each type of or
IgorLugansk [536]

Here are some potential benefits and harms of protists, fungi and plants:

  1. Protists:

Benefits: Some photosynthetic protists are one of the most important food source for many sea animals like sharks- the big giant aquatic creatures. They are responsible for producing 40% of the food that other organisms consume. Several little sea organisms like shrimp and larval crabs depend on protists for their food. Humans also harvest protests for food since they hold primary position in the food chain.

Harms: Like any other organisms, protists can also harm, especially to humans. There is a specific group of protists called animal-like protists that act as a parasite and harm human being.  

For example: a fatal disease malaria is caused by a protist called plasmodium that is transmitted to human through a mosquito bite. Malaria can cause symptoms like headaches, vomiting and fever, and in severe cases can lead to the death of individual.

     2. Fungi:

Benefits: Some fungi are very useful for humans like mushrooms. They are part of our delicious cuisines and add flavor and aroma to the food. Yeast is a fungi that is used to make bread and soya sauce. They are also source of useful compounds that scientists used to treat bacterial and viral infections.

Harms: Fungi can be really harmful to humans as well. They cause several diseases in humans and crops such as, Rusts and smuts on farm crops and orchards, Athletes foot and oral thrush in humans.

  3. Plants

Benefits: It won’t be wrong to say that we owe our existence to plants. They are not only important for humans but all other living organisms. Humans cannot survive more than few minutes without the supply for oxygen. Plants release the oxygen that humans use to breathe and survive.

Harms: Most of the plants are useful and just useful to us. They don’t eat us, run after us or kill us. However, some plants are so dangerous that only standing near them can cause harmful effects on human health. For example, the Manchineel tree is found throughout the Carribean and America, getting splash of its run off or inhaling its dust can quickly cause itching and swelling all over the skin. If you just touch its skin, your body will experience rashes quickly!

Hope it helps!

5 0
3 years ago
Similarities and differences between frogs and humans excretory system
Liono4ka [1.6K]
Frogs have only one opening, called the cloaca, through which both feces and urine pass. Humans, however, possess two separate orifices for urine and feces to exit through.
7 0
3 years ago
Meat contamination is generally due to select one:
Tju [1.3M]
I think it’s a .....
3 0
3 years ago
Other questions:
  • 1. Though Florida receives a lot of rainfall, only 1 percent remains available for people to use or drink. What happens to the r
    8·1 answer
  • True or false? The chemical make up food often changes when you cook it.
    15·1 answer
  • Lee and Celia are lab partners. While Celia pours a chemical into a graduated cylinder, some of the chemical splashes onto her a
    11·1 answer
  • How are the nervous system and endocrine system similar? how are the nervous system and endocrine system similar? the nervous sy
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Please answer::-- ;Anaerobic respiration is carried out by_______​.....
    12·2 answers
  • As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs? a. The polypeptide enters the E s
    11·1 answer
  • What is a recessive trait
    13·1 answer
  • Do hollow bones provide extra weight?
    12·2 answers
  • What was new york cities water pollution in parts per million 50 years ago
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!