Ask question

Ask question

All categories

2 years ago

15

HELP!!! will give brainliest!! need answer quickly!! An Ff mouse is bred repeatedly to an ff mouse, producing 500 total offsprin

g. In theory, 250 offspring should be black and 250 should be white, but the actual numbers are 237 black and 263 white. Why does this happen?

1 answer:

NeX [460]2 years ago

3 0

Cause 200 of them could die

You might be interested in

Which term best describes this collection of locations a forest a freshwater lake an estuary and a prairie

Katyanochek1 [597]

An estuary is partly enclosed coastal body of water with one or more rivers flowing through it, and with a free connection to the open sea. it would be more of a collection. hope this help have a great day.

4 0

3 years ago

List 2 famous geologic formations which can be found in the

Andrews [41]

Cheese,cheese,cheese,cheese, and more cheese. Ur welcome

4 0

3 years ago

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Kryger [21]

agcgggaugagcgcauguggcgcauaacug

4 0

3 years ago

What major organs would expect to find in the dorsal body cavity?

Nitella [24]

Lungs,heart,stomach,intestines

6 0

3 years ago

Difference between local system measurement and standard measurement

Anna71 [15]

Explanation:

hope it helps y.........

5 0

3 years ago

Read 2 more answers