Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Meninges are membranes that cover and protect the brain and spinal cord.
There are three layers of meninges: Dura mater (closest to the bone), Arachnoid loosely around the brain, Pia mater is closely attached to the brain and spinal cord surface.
In an open system such as a campfire, matter can <span>lose particles, gain particles or exchange particles.</span>
Answer: The means for transmission of disease-causing microorganism is provided by the direct or indirect contact.
Microorganisms can cause disease only once they are transferred to the body. The disease causing microorganisms are termed as pathogens which are transmitted by several ways such as from skin to skin, by nuclei droplets, through blood and body fluids or via air. In vector transmissions the disease is carried by the parasitic insects via animals, air borne transmission occurs when microorganisms move through air or the dust particles, droplet transmission occurs by coughing, sneezing or talking by the person who is infected while indirect transmission occurs by physical contact or by touching contaminated objects.
Answer:
jneuschafer is such a chad he didnt even add the answer for the points. but yeah, what he said
Explanation: