1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lidiya [134]
2 years ago
6

This is a ___________ gibbous moon.

Biology
1 answer:
LUCKY_DIMON [66]2 years ago
8 0

This is a new gibbous moon.

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What membrane protects the brain and spinal cord that circulates cerebral spinal fluid (csf) g?
nata0808 [166]
Meninges are membranes that cover and protect the brain and spinal cord.
There are three layers of meninges: Dura mater (closest to the bone), Arachnoid loosely around the brain, Pia mater is closely attached to the brain and spinal cord surface.
5 0
3 years ago
In an open system, such as a campfire, matter can_______<br><br> help plzz :))
xz_007 [3.2K]
In an open system such as a campfire, matter can <span>lose particles, gain particles or exchange particles.</span>
8 0
3 years ago
The means for transmission of disease-causing microorganism is provided by the ____. ​
Sergio039 [100]

Answer: The means for transmission of disease-causing microorganism is provided by the direct or indirect contact.

Microorganisms can cause disease only once they are transferred to the body. The disease causing microorganisms are termed as pathogens which are transmitted by several ways such as from skin to skin, by nuclei droplets, through blood and body fluids or via air. In vector transmissions the disease is carried by the parasitic insects via animals, air borne transmission occurs when microorganisms move through air or the dust particles, droplet transmission occurs by coughing, sneezing or talking by the person who is infected while indirect transmission occurs by physical contact or by touching contaminated objects.


6 0
3 years ago
Read 2 more answers
I'm stuck on this science problem
myrzilka [38]

Answer:

jneuschafer is such a chad he didnt even add the answer for the points. but yeah, what he said

Explanation:

7 0
2 years ago
Other questions:
  • Which would be a result of increased deforestation?
    13·2 answers
  • Approximately how old is the earth?
    13·2 answers
  • what role does molecular evidence play in determining how closely two species are related to each other
    13·1 answer
  • Explain 2 ways people can prevent further pollution of the ocean with plastic
    6·1 answer
  • List three differences between DNA and RNA:
    6·2 answers
  • Base your answer to the question on the information below and on your knowledge of biology.
    6·1 answer
  • Why is it important for something to satisfy all six characteristics of life in order to be considered a living thing?
    8·1 answer
  • What is the waste material liquid that is formed in the kidneys? _____
    15·2 answers
  • Describe the differences between work and power
    9·1 answer
  • Behavior modification to reduce self-injurious behaviors has been most successful in programs that rely on the use of:________
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!