2 years ago

HELP ME PLEASE!!!! answer the ones you know

1 answer:

5 0

Answer:

For example, the biceps muscle, in the front of the upper arm, is a flexor, and the triceps, at the back of the upper arm, is an extensor. When you bend at your elbow, the biceps contracts. Then the biceps relaxes and the triceps contracts to straighten the elbow.

You might be interested in

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

3 years ago

Earth’s Moon has a surface gravity equal to ____that of Earth’s surface gravity.

TEA [102]

A.one-sixth is your answer hope this helps

7 0

3 years ago

A population of prairie dogs lives at the edge of a meadow.

Shalnov [3]

Answer:

B. They belong to the same species and C. They live in the same area.

Explanation:

This is an educated guess. If you think about it, if there was a population of humansss, we dont have the same parents nor the exact genes so to only two that make sense is those to （＾ω＾）

5 0

3 years ago

Read 2 more answers

Which best describes work?<br> a.holding a pencil<br> b.lifting a feather<br> c.dropping a ball

Orlov [11]

B I think cause your lifting something up?

6 0

4 years ago

Read 2 more answers

In what part of the earth are tides the weakest?

Art [367]

The answer is near the equator. Hope that helps!

5 0

3 years ago