1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sophie [7]
2 years ago
15

Which step constitutes the power stroke of muscle contraction?.

Biology
1 answer:
Murrr4er [49]2 years ago
3 0
The myosin head moves toward the M line, pulling the actin along with it , as the actin is pulled, the filaments move approximately 10 nm toward the M line
You might be interested in
SCIENCE HELP!!!
valentina_108 [34]
1.) Charring a Marshmallow

2.) I think its B 
5 0
3 years ago
Read 2 more answers
Which of the following is an example of a ground in a building?
hjlf

Answer: its

A pipe to the ground

Explanation:

Just took the same quiz

4 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Wave size, strength, and dirrection cause A: deposition B: tides C: erosion D:refraction
serg [7]
The answer is c it's the best one
3 0
3 years ago
What is the biological significance of the temperature at which the amylase
kati45 [8]

Answer & explanation:

Amylase is part of enzymes, a group of large peptide molecules (formed by amino acids) whose role is to catalyze reactions in order to facilitate the synthesis of other biological molecules.

Amylase is found mainly in saliva (in the form of salivary amylase, or ptialin), acting in the breakdown of starch and glycogen in foods, reducing them to smaller particles, facilitating their digestion and absorption.

The action of enzymes depends on certain specific conditions, called optimal conditions. In the case of <u>amylase</u>, it depends on an optimum pH of 7 (neutral) and an optimum temperature of approximately 37 ° C.

This enzyme can still act between 35 ° C and 40 ° C, but below 35 ° C it is inactivated, preventing its functions from being performed, and above 40 ° C it suffers denaturation, causing changes in its structures.

Thus, it is concluded that the <u>temperature</u> (under optimal conditions) is important for enzymes because it keeps their actions and structures in proper operation.

3 0
3 years ago
Other questions:
  • Lizzie loves to stargaze at night. She has noticed that the moon appears to change shape over the course of the month, and she w
    11·1 answer
  • What are the three common parts of a nucleotide?
    14·1 answer
  • What defines a symbiotic relationship?
    8·1 answer
  • • in 1940 matthew and marion stirling found ________ at the site of ________.
    6·1 answer
  • Which type of mutation adds one or more base pairs?
    14·1 answer
  • John has two sisters and two brothers. Three of the five children in the family have dark brown hair, one has red hair, and one
    14·1 answer
  • Sam and Ben collected some pond water for science class. They wanted to see what was living in the water. They could see green a
    10·1 answer
  • WILL MARK U AS BRAINLIST
    5·1 answer
  • Winds in the Northern Hemisphere are deflected to the right, and winds in the Southern Hemisphere are deflected to the left.
    15·2 answers
  • Which of the following is not a function of a plant root?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!