1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anika [276]
3 years ago
9

What is the shape of DNA when it is not undergoing replication?

Biology
1 answer:
ArbitrLikvidat [17]3 years ago
3 0

Answer:

B.circular

Explanation:

You might be interested in
PLEASE HELP IM GIVING 30 POINTS AND BRAINLIEST!!!!!! PLEASE ​
Nostrana [21]

Answer:

a. uterus

b.ambiotic fluid

c.fetus

d.placenta

e.ambilical cord

f. cervix

i really hope this helps

4 0
3 years ago
According to the passage, what two things do jewelers have to consider when<br> making jewelry?
arlik [135]

Answer:

A. beauty and value

Explanation:

options are the following.

A. beauty and value

B. science and elements

C. beauty and science

D. gold and platinum  

Jewelers have to consider both beauty and science when  making jewelry because people chose those jewelry which is more attractive so beauty is the key component for the making of jewelry. Jewelers also know about the science which means he has to know different characteristic of metals which are used in making jewelry. Without this knowledge, the jewelry which is formed is of low quality.

8 0
3 years ago
Read 2 more answers
What gives carbon the ability to form chains that are almost unlimited in length?
tester [92]

The ability of carbon to form long chains is called Catenation.  

6 0
4 years ago
Read 2 more answers
Leukotriene receptor antagonists are administered orally. false true
Afina-wow [57]
The above statement is true. 
Leukotrines receptor antagonists are drugs that are administered for the treatment of asthma. They are among the most prescribed drugs for the management of asthma, used for the treatment and prevention of acute asthmatic attacks. They act by binding to the Cysteinyl leukotriene receptors and blocking their activation and the the inflammatory cascade. 
8 0
4 years ago
Will an object denser than water float or sink
olganol [36]
The density of an object determines whether it will float or sink in another substance. An object will float if it is less dense than the liquid it is placed in. An object will sink if it is more dense than the liquid it is placed in.

So an object denser than water will sink
3 0
3 years ago
Read 2 more answers
Other questions:
  • Offspring that are stronger or healthier than their parents are
    5·1 answer
  • Identify the word in italics.
    8·2 answers
  • Where do platypuses live?
    15·2 answers
  • Witch can disrupt the cell cycle? <br> A mutation <br> B G0 phase <br> C Replication<br> D cancer
    6·1 answer
  • The healing of a wound in a human is most similar to the process of
    13·1 answer
  • What is a theory????????
    6·1 answer
  • Need an answer thanks will mark as brainliest :)
    6·1 answer
  • A haploid cell (n = 8) undergoes mitosis. How many chromosomes will be in the daughter cells?
    11·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Write a claim indicating which type of beak has an adaptive advantage in Geospiza fortis during a drought. Next, provide evidenc
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!