1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
2 years ago
14

Why do leukocytes have a nucleus

Biology
1 answer:
ella [17]2 years ago
7 0

Answer:

so they can squeeze through blood vessels more quickly.

Explanation:

Some white blood cells have nuclei that are lobed, or separated into pieces, Other white blood cells act as factories making anti-germ weapons and need big nuclei to store the DNA to make those weapons.

You might be interested in
Is there a term for water's ability to bend around objects? (For example, how water, like any liquid, will curve around a rock t
Sav [38]
Viscosity refers to the speed at which a substance can flow (i.e. the thickness of the substance/its ability to flow). I think that's the closest the English language gets. 
8 0
3 years ago
Which statement is an example of a scientific theory?
Alchen [17]

Answer:

B

Explanation:

B is referring to cell theory, which basically states that all living things are made of cells and all cells come from other cells withe the exception of the first life forms.

6 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Some prokaryotes once classified in the domain Bacteria are now classified as
Ugo [173]
D






hope that helped :))
7 0
2 years ago
Can someone please help me !?
Sladkaya [172]
A is the answer
 hope this helps

3 0
3 years ago
Read 2 more answers
Other questions:
  • Global warming is primarily caused by an increase in the atmosphere of which gas a. CO2 c. ozone b. O2 d. CFCs
    14·1 answer
  • If a “W” looks like this, why isn’t it called a “double-V?”
    13·2 answers
  • houses have been built around a small retention pond, increasing the fertilizer runoff into the pond. This has led to algal bloo
    7·1 answer
  • In some flowers the ovary is hidden deep within the base of the flower while the pollen is held up in the air, often near a sour
    8·1 answer
  • Why would drinking very cold beverages have a negative effect on digestion of food in stomach?
    9·1 answer
  • 20 POINTS PLEASE ANSWER QUICK
    11·2 answers
  • I will give brainliest!!!! Which organelle, if punctured, would leak digestive enzymes into the cell's cytoplasm? Choose 1 answe
    9·1 answer
  • ___ is the process of producing cellular energy in the presence of oxygen.
    6·1 answer
  • What processes could cause a metamorphic rock to return to the surface of Earth to be worn down again?
    11·1 answer
  • Dna is cut at __ sequences by restriction enzymes.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!