Prokaryotic cells have nulcleus
2 answers:
Answer:
Prokaryotic cells are surrounded by a plasma membrane, but they have no internal membrane-bound organelles within their cytoplasm. The absence of a nucleus and other membrane-bound organelles differentiates prokaryotes from another class of organisms called eukaryotes.
Explanation:
hope it helps, God bless!
You might be interested in
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
