1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastovalidia [21]
3 years ago
11

You are responding to a call where an 8-year-old has been stung by a wasp. his skin is pale with patches of raised red spots on

his hands, arms, and face. these spots are most likely what?
Biology
1 answer:
Roman55 [17]3 years ago
3 0

Answer:

an allergic reaction to the wasp bite

Explanation:

this happens when a wasp first stings u it's only temporary of course

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
The function f(x) = 1.50x + 12.50 relates how much Kelsey pays for digital service, f(x), to the number of movies, x, she stream
NemiM [27]
F ( 18 ) = 1,50 * 18 + 12.50 = 27.00 + 12.50 = $39.50,
x - number of movies.
Answer: D ) $39.50; this is the amount Kelsey pays for 18 movies in 1 month
6 0
3 years ago
Read 2 more answers
Viewed Through A Microscope, A Sample Of Natural Water Is Seen To Contain A Cluster Of Sphere-shaped Bacteria, But No Rod-shaped
Inessa05 [86]

The natural water sample contains only one type of bacteria.


8 0
3 years ago
Read 2 more answers
What are genes composed of?<br> O offspring<br> O DNA<br> O cells<br> O traits
Crank

Answer: DNA (happy to help)

Explanation:

6 0
3 years ago
Why do sexually reproducing organisms need gametes? Why don’t asexually reproducing organisms need them?
Nana76 [90]
Gametes are reproductive cells that unite during sexual reproduction to form a new cell called a zygote. Sexual reproduction needs zygotes to reproduce that is why gametes are needed. Asexual reproduction doesn’t need gametes because there is only one parent and there is no fusion of gametes.
5 0
2 years ago
Other questions:
  • In the generation of most anions, the energy change (kj/mol) that _______ an electron is ________.
    9·1 answer
  • In human pedigree if a symbol is fully filled what does it represent?
    6·1 answer
  • Why don't cells continue to grow as an organism grows larger
    13·1 answer
  • Liverworts and mosses were some of the earliest land-based plants. Which statement correctly explains why these species are stil
    8·2 answers
  • A student wants to determine if exercise helps one to learn better. She conducts an experiment where 10 people start an exercise
    11·1 answer
  • What is the function of haemoglobin​
    12·1 answer
  • Which biomes receive less than 100 cm of rain each year? Select three options. tropical rain forest temperate rain forest desert
    11·2 answers
  • After mitosis are the two new daughter cells diploid or haploid?
    12·2 answers
  • Rearrange the information into a food chain. Label the role of each organism in the chain.
    14·1 answer
  • In pea plants white seed coat is a recessive trait and grey seed coat is a dominant trait. Which offspring have a white seed coa
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!