1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valentinak56 [21]
2 years ago
8

Genetic variation of individual chromosomes occurs during __________.

Biology
1 answer:
trapecia [35]2 years ago
4 0

Answer:

prophase I

Explanation:

Telophase II: Nuclear membranes reform.

Prophase I: The chromosomes condense

Interphase: Replication of DNA in preparation

Prophase II: There are now 2 cells.

You might be interested in
If two organisms reproduce asexually, then they will be able to produce offspring _______ two organisms that reproduce sexually.
elena-s [515]
C. More quickly than

3 0
3 years ago
Read 2 more answers
The mmpi is what? a. an iq test b. a projective test c. an objective test d. a blood test
lidiya [134]

Option c is the correct answer.

The MMPI is an objective test.

What is MMPI?

The MMPI is the objective personality test that is utilized the most commonly. Hathaway and McKinley released it in 1943, and in 1951, they rewrote it.

It has 566 questions that may be answered yes or no and is intended for people aged 16 and up. It can be given to an individual or a group, and the answer papers can be graded manually or automatically. The respondent is required to read each question, determine whether it applies to them personally, and then indicate their choice on the answer sheet. Eight clinical scales and four validity scales make up the test.

To learn more about MMPI click the given link

brainly.com/question/21770852

#SPJ4

7 0
1 year ago
RNA and DNA have different sugars in their backbones. Which sugar below belongs in DNA?
azamat

Answer:

B, deoxyribose means it has fewer oxygen molecules than ribose, choice B has fewer oxygens.

Explanation:

Dna stands for deoxyribose

8 0
3 years ago
A performer, seated on a trapeze, is swinging back and forth with a period of 8.90 s. If she stands up, thus raising the center
iren2701 [21]

Answer:

8.800s

Explanation:

When the performer swings, she oscillates in SHM about Lo of the string with time period To = 8.90s.

First, determine the original length Lo, where for a SHM the time period is related to length and the gravitational acceleration by the equation

T = 2π×√(Lo/g)..... (1)

Let's make Lo the subject of the formulae

Lo = gTo^2/4π^2 ..... (2)

Let's put our values into equation (2) to get Lo

Lo = gTo^2/4π^2

= (9.8m/s^2)(8.90s)^2

------------------------------

4π^2

= 19.663m

Second instant, when she rise by 44.0cm, so the length Lo will be reduced by 44.0cm and the final length will be

L = Lo - (0.44m)

= 19.663m - 0.44m

= 19.223m

Now let use the value of L into equation (1) to get the period T after raising

T = 2π×√(L/g)

= 2π×√(19.223m/9.8m/s^2)

= 8.800s

7 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • Donna is studying phase changes. She claims that since the three phases have different amounts of energy, molecules in substance
    12·2 answers
  • Mendel also proposed that the particulates separate independently into gametes, an idea known as:
    8·1 answer
  • Why some pigments (in plants with more than one) move further than others?
    9·1 answer
  • Several butterflies within a large population have wings with large dots on them. This wing pattern warns predators not to eat t
    8·2 answers
  • The rate of species extinction on Earth is currently very high—perhaps as high as it has been since the time of the dinosaur ext
    11·2 answers
  • Plant meristems produce new cells by which of these processes?
    10·1 answer
  • I’ll mark u brainly!
    15·1 answer
  • Why are metaphase chromosomes always used in the preparation of karyotypes
    12·1 answer
  • Name three elements used to date fossils with absolute dating
    14·1 answer
  • Proteins on the surface of vesicles determine where the vesicles go. Which cell organelle provides the instructions for these pr
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!