1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vekshin1
2 years ago
15

Where are pesticides found in the environment?

Biology
1 answer:
Lera25 [3.4K]2 years ago
7 0
It is d because pesticides run off into water, they are absorbed into soil , and they are left in the air , hope this helps :)
You might be interested in
What component of the blood does Warfarin affect
maksim [4K]
Anticoagulants such as heparin or warfarin (also called Coumadin) slow down your body's process of making clots. Antiplatelet drugs, such as aspirin, prevent blood cells called platelets from clumping together to form a clot. When you take a blood thinner, follow directions carefully.
4 0
3 years ago
Read 2 more answers
The nurse is considering risk factors for influenza in a group of preschool children. which factors are considered to place chil
Serggg [28]
There were no choices provided. But there is a related research about this situation. 

Risk factors of influenza transmission in households
Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1326070/

<span>>Reasons for increased transmission from children
</span>  The research pointed three causes. 
   1. Children are more exposed to different people in different places. their households, peers in schools and other children.

   2. Children especially preschools are said to have lower immunity which makes them prone and catching influenza.

   3.  Lastly, viral shedding among children can alleviate and spread period of infection.
4 0
3 years ago
Which hazard has occurred when you are working in a grain bin and you stand on or below the “bridged” grain, causing it to colla
FinnZ [79.3K]

<span>Suffocation is a most leading reason of death in grain storage bins. Grain handling industry is a high hazard industry where workers can be exposed to numerous serious and life threatening hazards. These hazards include: fires and explosions from grain dust accumulation, suffocation from engulfment and entrapment in grain bins, falls from heights and crushing injuries and amputations from grain handling equipment.  </span>

4 0
3 years ago
Which optical phenomena are formed by ice crystals?
azamat
Halo, any of a wide range of atmospheric optical phenomena
6 0
2 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Other questions:
  • Within the Amish community is an unusually high frequency of the gene that causes polydactylism (having 6 digits on one or more
    7·1 answer
  • What is the definition of population?
    8·2 answers
  • What occurs during absorption
    5·2 answers
  • True or False = A strand of DNA in a mouse contains the same base as the DNA of an octopus?
    9·1 answer
  • In bacterial genetics the term competence refers to a bacterium with ability to
    13·1 answer
  • Which causes a decrease in the amount of dissolved oxygen in a lake? A. lower temperatures B. fertilizer runoff C. overfishing
    8·1 answer
  • What is one event that may occur during Telophase I?
    13·1 answer
  • Day 16: SC.6.L.14.2 What are the three parts of the cell theory? (PG. 131) 1. All __________ are made of _________________ or __
    7·1 answer
  • Without the __, a plant wouldn't have any pollen.<br><br> fruit <br><br> stamen <br><br> nectar
    14·1 answer
  • ____ is a dimness of vision or the partial loss of sight without detectable disease of the eye
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!