1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
2 years ago
13

Stella described protein synthesis as a process that makes the necessary proteins for the human body to function. She

Biology
1 answer:
insens350 [35]2 years ago
7 0

The step of protein synthesis missed by Stella would be the translation of mRNA into amino acids.

The process of protein synthesis can essentially be divided into 2, namely:

  1. Transcription
  2. Translation

During transcription, genetic information on DNA is transcribed into mRNA. Once this is done, the genetic codes in mRNA are then translated to their respective amino acids and linked by peptide bonds.

The polypeptide bond undergoes further processing such as folding in the endoplasmic reticulum.

Thus, before amino acids can form a polypeptide chain, they must first be translated from genetic codes in mRNA.

More on protein synthesis can be found here; brainly.com/question/16305465

You might be interested in
How is over-irrigation damaging to soil?
Delvig [45]
<span>The question is asking how over-irrigation is damaging to soil. Over-irrigation means that too much water is being delivered to the soil, and too much water can wash some other important ingredients out - such as organic material. Therefore, the correct answer is: a. It reduces the amount of organic material in soil.</span>
3 0
3 years ago
Read 2 more answers
What’s the answer to this?
Vitek1552 [10]
It has to be c since they are growing
7 0
3 years ago
Fill in the missing words
g100num [7]

Answer:

when dna is dulpicated

Explanation:

4 0
3 years ago
Which of the following quantities is defined in terms of SI Units?
telo118 [61]

Answer:

Length

Explanation:

4 0
2 years ago
Matter has two basic properties physical properties and chemical properties which of these statements best describes physical pr
iren [92.7K]

I would say ones that can be seen, it affects the physical era of life eg H20 one of its physical qualities is its clear... coloress

6 0
3 years ago
Other questions:
  • Skin surfaces that lack hair contain specialized epithelial cells called which are sensitive to touch
    8·1 answer
  • According to ____________________ theorists, even the mate selection process is shaped by a calculation of exchange.
    14·1 answer
  • Research on differences in male and female brain activity has found that ________________, when doing language tasks, women's br
    5·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • The energy role of the first organism in a food chain is always a _______.
    11·2 answers
  • An organism has a haploid number of 8. what is the organism's diploid number
    15·2 answers
  • 1. Create a hypothesis for the question "How does sunlight affect flowers
    10·1 answer
  • What did Lamark believe about evolution? Why is this not correct? What is the first common evolution misconception? What does ev
    15·1 answer
  • What is used to measure when the cardiovascular system is receiving the most benefit from exercise without working too hard?
    12·2 answers
  • Which types of cells replicate using meiosis?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!