1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
15

Suppose that a population of bacteria triples every hour and starts with 400 bacteria. find an expression for the number n of ba

cteria after t hours.
Biology
2 answers:
Goshia [24]3 years ago
6 0
N should be 100 and hours 4 hope im right
amm18123 years ago
5 0

Answer: The equation would be n(t)= (400)3^t

Explanation:

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
What are the three main factors that affect barometric (air) pressure ?
Mars2501 [29]

Answer:

Temperature

Altitude or Elevation

Moisture or water vapour.

Explanation:

8 0
3 years ago
HELP PLEASE: The German scientist _______ noticed that the coastlines of Africa and South America looked like they might fit tog
andriy [413]

Answer: German scientist Alfred Wegener

Explanation: <em>In the early 1900s, the German scientist Alfred Wegener noticed that the coastlines of Africa and South America looked like they might fit together. He also discovered evidence that the same plant and animal fossils were found along the coasts of these continents, although they were now separated by vast oceans.</em>

7 0
2 years ago
A source from which organisms generally take elements is called
Anit [1.1K]

Answer:

A source from which organisms generally take elements is called exchange pool (option B).

Explanation:

Options for this question are:

  • <em>Food web.</em>
  • <em>Exchange pool.</em>
  • <em>Reservoir.</em>
  • <em>Biotic community.</em>

The term exchange pool is related to the biogeochemical cycles that exist in nature, referring to the source from which elements present in the environment become part of living organisms.

<u>Exchange pools are the biotic components</u> -like animals and plants- of an ecosystem, which determine the passage of elements between living beings. An element can remain as a reservoir (abiotic) in the soil, and then be incorporated into the exchange pool.

4 0
3 years ago
Sophie says dolphins and sharks look very similar so they must be related Jake disagrees says dna evidence has shown that the do
anyanavicka [17]

Answer:

Jake is correct.

Explanation:

Sophie is wrong because although dolphins and sharks can technically be said to be similar, it resulted from convergent evolution, which has nothing to do with common ancestry and rather to do with similar environments for their homes.

6 0
3 years ago
Other questions:
  • Replace with new samples of the powders and repeat, this time adding drops of the base. Record observations in the table.
    13·1 answer
  • UCP1 expression is increased specifically in adipose tissue. During glucagon signaling in adipose, what would be the fuel source
    14·1 answer
  • Which feature of model 1 best illustrates how biological information is coded in a DNA molecule?
    7·1 answer
  • Which of these is returned to the atmosphere when plants transpire?
    6·1 answer
  • Water's ___________ makes it an excellent solvent for salts, like sodium chloride, as well as other substances required by cells
    15·2 answers
  • Are you 100% sure of the parent’s phenotypes? Are you 100% sure of Maria’s phenotype? If not, which are problematic? Why?
    6·1 answer
  • Which of these resources are renewable? Check all that apply.
    6·2 answers
  • What role do maple trees play in a forest food web?
    6·1 answer
  • The equation for photosynthesis?
    9·1 answer
  • What is the structure and function of genes?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!