Answer:
DNA: ATGGGGGCGATATTTTATCCGACG
RNA: AUGGGGGCGAUAUUUUAUCCGACG
Protein: MGAIFYPT
Explanation:
Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.
Well it definitely breaks down the large glucose molecule into smaller molecules (H2O and CO2) but I'm not too sure about spontaneousness. I'd say nonspontaneous because it needs enzymes to work, even though it is exothermic...
Fossils can give us direct evidence of the character states of extinct lineages. For example, all modern birds lack teeth. Is the lack of teeth an ancestral or a derived condition? If we examine extinct species of theropods we see that they had teeth. Therefore we know that the lack of teeth is a derived condition in modern birds.
25%,1:3 This is due to the heterozygous condition to produce on homozygous long and one homozygous short then two heterozygous short.ie 1:2:1,but short is dominant and heterozygous short ate taken to be short ,thus modifying the ratio to 1:3,1:3 is 25%:75%.therefore homozygous long is 25%.
Greenhouse
thanks and follow me
