1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OleMash [197]
2 years ago
12

1. Which statement shows the direction of the transfer of heat in this experiment?

Biology
1 answer:
ivolga24 [154]2 years ago
8 0

Answer:
Light bulb to Paper

Is higher for the black paper

The white paper absorbs less heat

Explanation:

Took on edge, hope this helps!

You might be interested in
When a honeybee pollinates flowers, the bee gets access to nectar, while the flowers gain the chance to reproduce.
Luda [366]

Answer:

It would be mutualism because they both benefit from the situation

Explanation:

8 0
3 years ago
When you eat a meal, food is digested and monomers like glucose are transported throughout your body. food is transformed and us
Alchen [17]
<span>Food molecules like lipids, proteins and polysaccharides are broken down enzymatically via digestion process, which occurs in our intestine cells (digestive system). Those large polymeric molecules are broken down into their monomer subunits—proteins into amino acids, polysaccharides into sugars, and fats into fatty acids and glycerol. Formed small organic molecules are now ready for the oxidation (a process that produces ATP and consumes O2) which occurs partly in the cytosol and in the mitochondrion. Oxidation processes include glycolysis and citric acid cycle which are differently required in different tissues. Nervous system (nerve cells) rely almost entirely on a constant supply of <span>glucose<span> from the bloodstream. In contrast, liver cells supply glucose to actively contracting muscle system which needs a lot of ATP energy.</span></span></span>
4 0
3 years ago
Read 2 more answers
At the coordinates 45 degrees W &amp; 72 degrees N it is 9:32 AM. What time is it at the coordinates 75 degrees W &amp; 45 degre
garik1379 [7]

Answer:

The correct option is;

7:32 AM

Explanation:

The information given are;

The time at 45 degrees W and 72 degrees N = 9:32 AM

The variation of time with lines of longitude  is given as 15 degrees for each 1 hour variation, therefore, where we have the other location at 75 degrees W and 45 degrees S, the difference in the longitude = 75 - 45 = 30 degrees west  of the initial location

Moving west is in the opposite direction of the Earths rotation, therefore, we subtract 1 hour for every 15 degrees giving 30/15 = 2 hours subtracted

The time at 75 degrees W and 45 degrees S is therefore, 9:32 AM - 2 hour = 7.32 AM

The latitude of a place left out in the calculation of the relative time of a place.

8 0
3 years ago
3.Commercial development in the U.S. has resulted in an increase in the number of roads, housing developments, shopping centers,
Art [367]

The correct answer is option A, that is, development often causes habitat fragmentation, which can threaten biodiversity.

Fragmentation is usually illustrated as a reduction in some of all the kinds of natural habitats in a landscape, and the differentiation of a landscape into smaller and more isolated segments. With the development of the fragmentation process, the ecological influences will modify.  

Fragmentation can be a result of natural procedures like floods, fires, and volcanic activity, but it is more generally caused due to human activities like an increase in the number of roads, housing developments, shopping centers, and parking lots.  

With the enhancement in human activities, the effect of fragmentation become more. Eventually, it results in the devastating influences on the local species, a complete modification to the landscape, and the loss of the region's wilderness heritage.  


3 0
3 years ago
The animals living in the deeper parts of the seafloor, _____.
Lelu [443]
C is what i think is correct.
7 0
3 years ago
Read 2 more answers
Other questions:
  • 6−3q≤1 solve the problem for 25+ points
    8·2 answers
  • Which Biome do we live in?
    14·1 answer
  • 1. Which bond is broken when energy is released? can anybody help me please I will pick brainiest!
    10·1 answer
  • Name two ways you can see a spectrum.
    8·1 answer
  • A more ______ design can reduce earthquake damage to buildings
    10·2 answers
  • New biosensors, applied like a temporary tattoo to the skin, can alert serious athletes that they are about to "hit the wall" an
    5·1 answer
  • What structural difference accounts for the functional differences between starch and cellulose?
    12·2 answers
  • What are two Amphibian behaviors
    13·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • a group of primitive cells that have the same number of mitosis all daughter cells that result from mitosis meiosis gametogenesi
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!