1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Genrish500 [490]
3 years ago
12

(multiple choice) Daytime temperatures on Mercury are extremely hot because:

Biology
2 answers:
Gnom [1K]3 years ago
8 0
The reason why is Because it closes to the sun
Law Incorporation [45]3 years ago
8 0

im pretty sure it gives internal heat

You might be interested in
What term describes a substance that has a positive and negative region in a molecule
Gekata [30.6K]

Zwitterion

Zwitterion also known as dipolar ion refers to a substance that has at least one positive and one negative electrical charge at different locations and the net charge of the entire molecule is zero. Examples of zwitterions are amino acids.






6 0
3 years ago
What are the primary tools of fiscal policy? government spending and capital budgets interest rates and money supply operating b
Nana76 [90]

Answer:

Fiscal policy refers to the use of the government budget to affect the economy. ... Generally, expansionary policy leads to higher budget deficits, and contractionary policy reduces deficits. An expansionary fiscal policy leads to higher budget deficits while a contractionary policy reduces deficits

Explanation:

plz follow me and mark me as brainlliest

5 0
3 years ago
_______parenting is a belief, or a way of living, that teaches and emphasizes good behavior in the process of raising children.
sammy [17]

Answer:

Positive is the correct answer.

Explanation:

5 0
3 years ago
In garden peas the allele for tall plants () is dominant over the allele for dwarf plants() A true breeding tall plant is bred w
marta [7]

Answer: This is called Monohybrid Experiment

Explanation: Monohybrid Cross

P Generation TT     *   tt

  Tall plants     Dwarf plants

F1 Generation  

T T

t Tt Tt

t Tt Tt

In F1 generation;

There are 100% Tt Genotype and 100% Tall plant Phenotype

F2 Generation

F1   *   F1

( Tt   *   Tt )

T t

T TT Tt

t Tt tt

In F2 Generation;

Genotype

There are 25% TT (homozygous dominant, tall plants).

50% Tt (heterozygous tall plants), and

25% tt (homozygous recessive dwarf plants).

This is how dwarf characteristics reappear in the second generation.

The Phenotype of F2 generation is 3:1  (Tall : Dwarf)

I have attached a document to this answer to facilitate effective understanding if there is anormalities in arrangement the Punnet Square.

Download docx
5 0
3 years ago
A solution that contains equal numbers of hydrogen and hydroxyl ions would be called
alukav5142 [94]
Acidic basic alkaline neutral
6 0
4 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • When you look at the Sun through a filtered telescope, you notice a blotchy appearance.
    8·2 answers
  • Which explanation best explains the role of enzymes as catalysts in living systems?
    8·1 answer
  • Compare the stucture of a food web with a food chain
    13·1 answer
  • A student believes that ducks swim faster when they are in cold water. He tests two groups of ducks, one in cold water and one i
    14·1 answer
  • What human activity would have the most significant effect on the temperature of the earth?
    15·2 answers
  • State your claim. Make sure your claim fully explains how infrared photography can be used to visualize temperature differences​
    15·1 answer
  • Can someone help me label the rest of them
    13·1 answer
  • Why does meiosis have two stages of cytokinesis? Four daughter cells are produced so the cell needs to divide twice, The chromos
    7·1 answer
  • What is the function of the mouth in the digestive system
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!