1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Butoxors [25]
2 years ago
13

Hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

Biology
1 answer:
Viktor [21]2 years ago
6 0

Answer:

the answer isnt h, its jjjjjjjjjjjjjjjjjjjjjjjjj

Explanation:

its j because its 2 letters away from h

your welcome

You might be interested in
Rotenone is a drug which binds complex I of the electron transport chain and inhibits it from functioning.
MAXImum [283]

Answer:

a) No; b) Yes; c) Down

Explanation:

a) No: Rotenone inhibits the transfer of electrons from complex I to CoQ of the electron chain by inhibiting the oxidation of NADH to NAD.

b) Yes: Besides receiving electrons from complex I, FADH2 receives electrons  from fatty acids and glycerol-3-phosphate. 2 ATPs are produced from FADH2.

c) Down: Less oxygen will be broken down (or consumed) to water, instead some of it will be converted to reactive oxygen species.

4 0
3 years ago
While poison is the main suspect in the case, what are other ways a person could die of hypoxia
Vladimir79 [104]
Hypoxia can result in lung damage due to trauma and can also happen if the person has bronchitis or pneumonia. hope this helps:)
8 0
4 years ago
Read 2 more answers
B Explain why animals need plant biomass.
Burka [1]

Answer:

its in the type of nutrience they have

Explanation:

5 0
3 years ago
Read 2 more answers
What is coronary ligament
aev [14]
A coronary ligament consists of two layers- an upper and a lower. The upper layer is formed by the reflection of the peritoneum from the upper margin of the bare area of the liver to the under surface of the diaphragm, and is continuous with the right layer of the falciform ligament.
7 0
3 years ago
Read 2 more answers
In an observational study researchers try not to
o-na [289]

Answer:

D

Explanation:

5 0
4 years ago
Other questions:
  • An onset of industrialization results in which part of the s curve model
    7·1 answer
  • A(n) _________ is a frozen mass of different types of ice and dust that orbits the Sun.
    7·2 answers
  • Energy is converted from solar to chemical in Process A and then from one form of chemical to another in Process B.
    6·2 answers
  • State and describe the kind of relationship that exists between seagull and turtle
    11·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • you are feeling a lot of fear. the brain site most likely involved is the midbrain. the left hemisphere. the right hemisphere. t
    13·1 answer
  • Which answer choice below BEST explains the difference between genotype and
    14·1 answer
  • Which best explains mantle convection
    10·1 answer
  • When we breathe in and out normally during rest, this is called “quiet” inspiration (and expiration). It is also called tidal vo
    10·1 answer
  • The gulf and the Dead Sea are extended of the same geological rift that resulted in the opening of the Red Sea is in which cardi
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!