1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nookie1986 [14]
2 years ago
8

2. What are the steps of Binary Fission?

Biology
2 answers:
BaLLatris [955]2 years ago
4 0

Answer:

see the file attached!!

lana66690 [7]2 years ago
3 0

Answer:

i hope this helps

Explanation:

lag phase.

log/exponential growth phase.

stationary phase.

death/logarithmic decline phase.

You might be interested in
What class of rock is basalt?
Georgia [21]
It a rock form from extrusive rock such as the follow of lava
3 0
2 years ago
Which of the following statements is false?Algae are used to make many commercial products, like marshmallows and paint.Algae ca
yarga [219]

Answer:Algae contributes to the phosphorus cycle

Explanation:Algae are organisms which have distinct chlorophyll and are autotrophic in nature .Most of them live in water.Algae include the Unicellular chlamydomanas and the multicellular sea weed.some algae are colonial and some are filamentuous.Algae possess chlorophyll, carotenoids and phycobillins as pigments.

Algae are important primary producers in the water bodies and produces a significant portion of oxygen.

Some algae eg diatoms are fossilized due to their glass cell wall and are known as diatomaceous earth, which has various uses such as abrasives,tooth paste and as filters.

Red algae produces calcium carbonate which forms coral reefs.

The products of some algae are used as solid gels and source of agar for microorganism culture.

5 0
3 years ago
In what bodies does chlorophyll exist in plants?
AnnyKZ [126]

Answer:

Stems

Explanation:

6 0
3 years ago
The evolutionary theory that suggests that a species can suddenly and rapidly evolve into a new species is ?
Mekhanik [1.2K]

<span>Punctuated Equilibrium/ Equilibria proposes that once species appear in the fossil record, the population  will be in the state of little or absent morphologic change. This is called a state of stasis. The theory further proposes that the population is confined to infrequent and geographical rapid events when significant evolutionary change happens.  The parent species will the split into two distinct species. This process if called cladogenesis.</span>

6 0
3 years ago
What is the phenotype ratio for this cross ?
Dmitrij [34]

Answer: 2 Heterozygous Tall and 2 homozygous short.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Use of which of the following does not contribute carbon dioxide to the environment
    5·1 answer
  • Which sentence describes the distinction between algae and plants?
    12·2 answers
  • What fat are broken down to enter the respiratory system?
    8·1 answer
  • What is a major difference between facilitated diffusion and active transport?
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • One reason tundra plants are small and grow close to the ground is that _____.
    9·1 answer
  • The phenomenon of multiple, overlapping action potentials gradually building muscle tension is called:
    5·1 answer
  • Electrons are removed from glucose to fuel which process in aerobic cellular respiration
    13·1 answer
  • Match each source of stem cells with the appropriate description.
    7·2 answers
  • Flowering plants are ___.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!