1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SIZIF [17.4K]
3 years ago
11

Which results in differences among specialized cells of organism

Biology
2 answers:
sergiy2304 [10]3 years ago
8 0

Answer:

Cellular differentiation is often controlled by cell signaling. Many of the signal molecules that convey information from cell to cell during the control of cellular differentiation are called growth factors. ... Cells and tissues can vary in competence, their ability to respond to external signals.

Explanation:

fredd [130]3 years ago
3 0
May I see the picture closer
You might be interested in
I need help on questions 54-57
VladimirAG [237]
How would u approach the first one, #54
7 0
3 years ago
The formation of clouds is caused by which of the following?
insens350 [35]

Answer:

condensation

Explanation:

once evaporation occurs the water vapor rises and condenses into clouds when it hits the colder air higher in the atmosphere.

4 0
2 years ago
eukaryotes a. are larger than prokaryotes b. have many different specialized organelles c. contains a nucleus d. all of the abov
Kryger [21]

Answer:

d.  all of the above​

Explanation:

5 0
2 years ago
How many food chains are in this food web?
Andre45 [30]

Answer:

There are 8 food chains

Explanation:

5 0
2 years ago
Faith believes that she is the reincarnation of cleopatra. faith is most likely suffering from _____.
KATRIN_1 [288]
Hello There!

<span>Faith believes that she is the reincarnation of Cleopatra. Faith is most likely suffering from delusions of grandeur.</span>

Hope This Helps You!
Good Luck :) 

- Hannah ❤
6 0
2 years ago
Other questions:
  • What is the "goal" of an element in bonding chemically (what does it need to do to be stable"
    10·1 answer
  • What structure holds chromatids together in double stranded chromosomes? What are they known as
    7·1 answer
  • Which of the following correctly pairs a biomolecule to its function
    13·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • You are wading in a river and watching the water waves washing over your feet if one of the waves washes over your feet every tw
    6·1 answer
  • What is a gamete?
    13·1 answer
  • Five major kinds of species interaction
    13·1 answer
  • Hich term represents animals with backbones?
    14·1 answer
  • What is the term used to describe any living or nonliving things that influence another living organism? (1 point)
    6·1 answer
  • How are the electrons in the PS II system replaced?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!