1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
2 years ago
11

Amoeba and paramecium are prokaryotes give reason

Biology
2 answers:
Kay [80]2 years ago
5 0

Answer:

They are both eukaryotes for several reasons.

Explanation:

Some of these reasons are that their nuclei aren't well-defined and they are made up of one single cell. Hopefully, this helps- if so, I would love Brainliest!

Marysya12 [62]2 years ago
4 0

\huge \color{pink}{A}\color{blue}{n}\color{red}{s}\color{green}{w}\color{grey}{e}\color{purple}{r }

  • Amoebas, paramecia, and euglena are all considered eukaryotic cells because they contain membrane-bound organelles which include a defined nucleus....

Hope it helps ~

You might be interested in
*Biology* Please help!
fomenos

Answer:

3:1

Explanation:

i hope it will be helpful

5 0
2 years ago
NEED HELP NOW. A chemical reaction occurs that involves combining 1 atom of zinc with 2 atoms hydrogen and 2 atoms of chlorine.
Leni [432]

Answer:

1 Zinc, 2, Hydrogen, 2 Chlorine

Explanation:

5 0
3 years ago
13. What happens when a protein is deNtured?
soldier1979 [14.2K]

<em>Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state. Denatured proteins have a looser, more random structure; most are insoluble.</em>

7 0
2 years ago
What is the main function of the immune (lymphatic) system?
jekas [21]

Answer:

<h2>A. Keeping a body healthy from disease</h2>

5 0
2 years ago
Read 2 more answers
A scientist breeds two different varieties
olga_2 [115]
Selective breeding
hope this helps
5 0
3 years ago
Other questions:
  • What is the difference between a law about gravity and a theory about gravity?
    7·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What happens to body systems over time
    10·2 answers
  • A property of life known as energy processing refers to the fact that living things:_______.A. can reproduce.B. obtain energy fr
    8·2 answers
  • Producers are the most important biotic factor in an ecosystem<br><br>true or false?
    6·1 answer
  • Based on the passage, FSHRs are found on cells of which type(s) of tissue? Connective Epithelial Nervous I only III only I and I
    9·1 answer
  • Which causes vasoconstriction? a. α-Adrenergic antagonist b. Calcium channel blocker c. Acetylcholine d. Norepinephrine
    5·1 answer
  • happens slowly over time only occurs below the species level is any change in the DNA of an organism can be caused by genetic dr
    10·1 answer
  • 1. Why is biodiversity important to ecosystem?
    6·2 answers
  • Please help! I am giving lots of points for this.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!