1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreyandreev [35.5K]
2 years ago
5

Describe a hypothetical example showing how rising sea levels due to global warming might cause extinction.

Biology
1 answer:
german2 years ago
4 0

Answer:

Global warming may cause more icebergs to melt than are created. This would lead to higher sea levels. Sea levels may rise above land masses located at low elevations. As a result, the animals who lived in these areas may find their habitats shrinking and resources depleting, causing their population size to decrease. If there are particular species that were only able to survive in the areas now covered by water, they may very well become extinct.

You might be interested in
BRAINLEST TO FIRST CORRECT ANSWER!!!
Basile [38]
Question 4 is b not d
5 0
2 years ago
Read 2 more answers
A change in the base pairs is called a what?​
slavikrds [6]

Answer:

Hey mate.....

Explanation:

This is ur answer.....

<em>Substitution is a type of mutation where one base pair is replaced by a different base pair. The term also refers to the replacement of one amino acid in a protein with a different amino acid.</em>

Hope it helps!

Brainliest pls!

Follow me! :)

6 0
2 years ago
Read 2 more answers
"after 12 hours without eating, seth is very hungry. it is likely that seth's blood glucose level is _______________ and his blo
viva [34]
After 12 hours without eating, Seth is very hungry. It is likely that Seth's blood glucose level is LOW and his blood insulin level is HIGH.
A situation in which the blood glucose level is low is called hypoglycemia. In this situation, the level of glucose in the blood is much more lower than the normal level. This may be caused by a lot of factors. When the blood glucose level is low, the glucagon hormone mobilize the liver to release glycogen which is converted to glucose. The presence of glucose in the blood increase the level of insulin secretion which in turn increased the feeling of hunger in the individual. 
8 0
3 years ago
A food service employee with an open cut or wound may be permitted to prepare food if the:
Alex
Man wears gloves and has protective clothing
5 0
2 years ago
Read 2 more answers
Name two models used<br> to show the transfer of<br> energy in an ecosystem
aleksandr82 [10.1K]

Answer:

Flow of Energy can be explained by means of two models namely: single channel energy model and Y-shaped energy model.

Hope this helps :)

3 0
3 years ago
Other questions:
  • Imagine that you are studying the control of β-globin gene expression in immature red blood cells. (Mature red blood cells conta
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Parts of the cells!​
    15·1 answer
  • Thought and memory pass across synapses in the brain. What are the neural circuits transmitted by new or reactivated pathways ca
    14·1 answer
  • What should you use to secure a slide?
    14·1 answer
  • Applying Science and Mathematics to solve real-world problems is called​
    6·2 answers
  • Identify the process in Model 2 that describes an artificial (purely human-caused) process that moves carbon.
    11·1 answer
  • Explain the flow of blood from a leg muscle to the heart and lungs and back to the muscle again listing each organ the blood tra
    10·1 answer
  • What is the result of crossing over, as shown in the illustration? o the chromosomes replicated o the chromosomes condensed o th
    13·1 answer
  • Most archaeologists believe that the __________ was one of the earliest centers of plant and animal domestication.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!