1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreyandreev [35.5K]
2 years ago
5

Describe a hypothetical example showing how rising sea levels due to global warming might cause extinction.

Biology
1 answer:
german2 years ago
4 0

Answer:

Global warming may cause more icebergs to melt than are created. This would lead to higher sea levels. Sea levels may rise above land masses located at low elevations. As a result, the animals who lived in these areas may find their habitats shrinking and resources depleting, causing their population size to decrease. If there are particular species that were only able to survive in the areas now covered by water, they may very well become extinct.

You might be interested in
What does d represent in the equation below? m = M + 5 log(d/10)
damaskus [11]
<span>C. absolute magnitude. hope it helps</span>
4 0
3 years ago
Read 2 more answers
Every time there is a full moon, Mrs. Cook insists that students in her classes display strange behavior. What would be the best
zheka24 [161]
Every time when there is a full moon, Mrs. Cook insists that students in her classes display strange behavior and the best way for her to prove the validity of her theory is to research data to find concrete evidence of a link between the moon cycle and human behavior. Hope this helps. The answer is B
8 0
3 years ago
Which sentence correctly describes the relationship between DNA, genes, and chromosomes? A gene is a segment on the DNA. DNA is
kotykmax [81]
<h2>Answer:</h2>

The correct statement is option A which is, "A gene is a segment on the DNA. DNA is wrapped in proteins to form a chromosome".

<h3>Explanation:</h3>
  • A gene is the part of DNA in the nucleus which encodes for the specific trait in the body. DNA is the nucleotide sequence which is the blue print for the whole organism. It contains genes for all the structures and functions in the body.
  • So it is very long sequence containing the million of genes. So in nucleus it is present in compress form. It is wrapped on the histones proteins and condense and supersondense into a specific structure which is known as chromosome.
8 0
3 years ago
Read 2 more answers
Which statements apply to comets? Check all that apply.
lora16 [44]

Answer:

formed of ice, rock, and dust

develop tails near the Sun

Explanation:

Comet is a smaller celestial body which is mainly composed of ice and dust.

The other components of this comet are rocks and gas.

When any comet approaches a sun it can deliver a tail of dust or gas.

hope this will help you

5 0
3 years ago
How would you expect a bacterium near the end of binary fission to look?
Rainbow [258]
The bacterium should be 2 separate identical bacterium
8 0
3 years ago
Other questions:
  • Brown eyes in humans are dominant to blue eyes. A brown-eyed man, whose mother was blue-eyed, marries a brown-eyed woman whose f
    10·1 answer
  • Both dna and rna are made up of building blocks known as
    15·2 answers
  • Read the scenario below and answer the question that follows.
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Please help me!<br> Drag each image to the correct location on the chart. Tundra or desert.
    14·1 answer
  • Energy is released during chemical reactions that occur in
    11·1 answer
  • Hi can u please do a cell foldoble about what they contane is for a grade plz
    6·1 answer
  • 1. What percentage of trees are found in the taiga &amp; how much<br> oxygen do they help replace?
    14·1 answer
  • a person whose blood group is B required blood transfusion name the possible blood groups of the donors​
    13·2 answers
  • (b) A student tested some albumen for the presence of protein using Biuret reagent.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!