1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinil7 [7]
2 years ago
7

Why do you think bright feathers make a male duck a desirable mate?

Biology
1 answer:
lesya692 [45]2 years ago
4 0
In competition, males use feather color to warn potential rivals that they occupy a piece of territory.
You might be interested in
Why was miasma theory replaced?
vredina [299]

Answer:

Miasma theory was replaced because John Snow collected data that showed that germs cause disease.

Explanation:

The theory of miasma was proposed in the past when some scientists —like doctors Thomas Sydenham and Giovanni Maria Lancisi— thought that disease was the product of emanations originated by the decomposition of organic matter. This theory was based on the fact that diseases predominated in places with poor hygienic conditions.

John Snow, an english physician, was one of the main contributors to the <u>microbial theory of disease</u>. In 1854, while a cholera epidemic was occurring, he collected data and organized it statistically and then concluded that the disease was caused by germs present in drinking water. This <u>data was contrary to the miasma theory, which would eventually be displaced by the microbial theory of the disease</u>.

5 0
3 years ago
A group of 250 women over the age of 40 are recruited for a study to determine the effects that calcium has on bone health. Half
egoroff_w [7]

Answer:

A. True

Explanation:

The result indicates that taking calcium has no effect on the development of osteomalacia in the women. This is because, of the over 120 women placed on the calcium supplements, it happens to be minimal number of people ( less than 20 people) that develop the osteomalacia disease of the bone.

6 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Your teacher says that your hypothesis for a experiment cannot be proven. Do you agree, or do you disagree? Explain your answer
Ilya [14]
It could be a yes or no... to me because you try something you did try an put your work in to it when it was hard work.... I agree because you always try when you do something... if it can't be proven at least you tried on it
3 0
3 years ago
One strand in a segment of a gene has the base sequence TGCTTA. What would be the complementary sequence of nucleotides found on
yarga [219]

The complementary sequence of nucleotides found on the other strand of DNA is <u>ACGAAT</u> when one strand in a segment of a gene has the base sequence TGCTTA.

<u>Explanation:</u>

Deoxyribonucleic acid is the one which carries the genetic information from the parent to the offspring.  During DNA replication one strand of DNA replicates to produce another strand.        

The DNA molecule have a anti-parallel structure and the two strands run in opposite direction. If in one strand in a segment of a gene has the base sequence TGCTTA the complementary sequence of nucleotides found on the other strand of DNA will be ACGAAT.

6 0
3 years ago
Other questions:
  • Between 1955 and 2012 the global TFR Rose from 2.4 to 5 true or false
    15·1 answer
  • Why are fossil fuels considered nonrenewable resources if they are still forming beneath the surface today?
    6·2 answers
  • An observation which requires measurement is called:
    11·1 answer
  • Role of mulluscus in soil
    15·1 answer
  • Which of the following is a possible entire nucleotide found in a DNA molecule? (1 point)
    10·1 answer
  • Male Australian bowerbirds build and decorate elaborate structures, called bowers, out of grasses and other vegetation. If we wa
    5·1 answer
  • Which of these is true about DNA, proteins, and the expression of genetic traits? A. Enzymes break down DNA, releasing amino aci
    5·1 answer
  • When are fossil fuels harmful to the environment?(No links please!!)
    12·2 answers
  • Which of the following is used to describe DNA's double helix shape?
    6·2 answers
  • 4. The peppered moth lives on the trunks of trees in England. There are two colorations of this moth, light and dark, and both
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!