1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ipn [44]
2 years ago
14

Explain what fossils can tell us about ancient life

Biology
1 answer:
mart [117]2 years ago
7 0

\large\underline{\mathbb{AnSwEr}:}

\pink{ \rule{80pt}{100000pt}}

You might be interested in
The embryo implants itself to the walls of _________.
Anni [7]
It implants itself to the walls of the uterus (endometrium) by umbilical cord.
5 0
3 years ago
Help please!!!!<br> I will mark you brainliest if i get the correct answer<br> I need ASAP!!!!
yuradex [85]

Answer: c is the answer

Explanation: it the answer because spud waves travel without the air u hear it

5 0
3 years ago
Read 2 more answers
If someone sitting at the other end of a restaurant smokes a cigarette, you may still breathe some in some of the smoke. The mov
34kurt

Answer:

C.facilitated diffusion

Explanation:

Because it have some chemicals did you breathe from the person who using cigarettes.

8 0
3 years ago
A ________ is a model that imitates a real-world situation. What goes in the blank? Also my other question is, A _________ is an
Marina CMI [18]
First one is Model and second one is Inference
8 0
3 years ago
if a scientist wanted to compare the expression of one gene under two sets of conditions, what technique would they use?
timurjin [86]

If a scientist wanted to compare the expression of one gene under two sets of conditions, chain termination is the technique they would use.

Chain termination is any chemical response that ceases the formation of reactive intermediates in a sequence propagation step withinside the route of a polymerization, efficaciously bringing it to a halt.

Sanger sequencing, additionally referred to as the “chain termination technique”, is a way for figuring out the nucleotide collection of DNA. The approach become evolved with the aid of using time Nobel Laureate Frederick Sanger and his colleagues in 1977, subsequently the call the Sanger Sequence.

To learn more about technique, click here:

brainly.com/question/4974917

#SPJ4

4 0
1 year ago
Other questions:
  • HELP PLEASE ASAP!!!! I don't understand this
    14·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Damages Before buying a house, Dean and Donna Testa hired Ground Systems, Inc. (GSI), to inspect and describe the sewage and wat
    13·1 answer
  • How meiosis causes cancer?
    10·1 answer
  • Write three observations that could help you identify this fish.
    15·2 answers
  • How does crossing over affect the genes being passed on to the offspring??
    9·1 answer
  • What type of macromolecule is ATP?
    14·1 answer
  • The area around a cell has a high concentration of sodium ions As a result the cell membrane expands and burst which problems wa
    7·1 answer
  • Which of the following is an irrational number?
    5·1 answer
  • True or False: Mass changes when gravitational force changes.<br> A<br> True<br> B<br> False
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!