Answer:
1. false
2. true
3. true
Explanation:
1. Annuals are the plants that complete their life cycle in one season or one year. These are the herbaceous plants that grow, flower and die in one season. Examples of annuals are geranium, marigold, etc.
2. In a flower, the whorl of petals is called corolla while the whorl of the sepal is known as calyx. In flowers, calyx and corolla together make perianth. The calyx is outer to corolla in a perianth.
3. The fruit is a matured and ripened ovary that provides protection to the seeds present in it. Fruits are formed after fertilization and may contain one or more seeds. Tomatoes are the simple berry fruits while cucumber is pepo, the modified berries. Broccoli is the flower head while celery is the edible leaf.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Richter's original magnitude scale (ML) was extended to observations of earthquakes of any distance and of focal depths ranging between 0 and 700 km. Because earthquakes excite both body waves, which travel into and through the Earth, and surface waves, which are constrained to follow the natural waveguide of the Earth's uppermost layers, two magnitude scales evolved - the MB and MS scales.
The standard body-wave magnitude formula is
MB = log10(A/T) + Q(D,h) ,
where A is the amplitude of ground motion (in microns); T is the corresponding period (in seconds); and Q(D,h) is a correction factor that is a function of distance, D (degrees), between epicenter and station and focal depth, h (in kilometers), of the earthquake. The standard surface-wave formula is
MS = log10 (A/T) + 1.66 log10 (D) + 3.30 .
There are many variations of these formulas that take into account effects of specific geographic regions so that the final computed magnitude is reasonably consistent with Richter's original definition of ML. Negative magnitude values are permissible.
Answer:
b. Some carbon dioxide will move from chamber A to chamber B.
Explanation:
The two chambers are separated from each other by a separator that exhibits the properties of the cell membrane. It means that the separator film is semi-permeable in nature. The concentration of CO2 in the chamber A is 80%. This is relatively higher than its concentration in chamber B (20%). The concentration gradient will drive the passive diffusion of some of the CO2 from chamber A to chamber B so that the concentration becomes equal in both the chambers.
