What was the investigation? But from my best guess I'm assuming it's the second option. This may be incorrect.
The 3 is vaporization and solidification
4 is vaporization
5 is solidification
Homeostasis is the maintenance of a stable level of internal conditions even though environmental conditions are constantly changing. Metabolism is the sum of all the chemical reactions that take in and transform energy and materials from the environment.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
1) A mutation appeared in one weed plant that made that weed not susceptible to the herbicide ( B )
2) The weed will survive long enough to reproduce ( B )
Explanation:
1) The most likely reason the weed remained is : A mutation appeared in one weed plant that made that weed not susceptible to the herbicide
The weed plant must have undergone some mutation in order to be resistant to the herbicide which would kill the weed before now
2) The most likely thing that will happen if the weed stays in place in that farm is : The weed will survive long enough to reproduce
The trait or mutation of the weed cannot just spread to other weeds nearby it can only spread by reproducing more weeds of same mutation
