1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Charra [1.4K]
1 year ago
7

HURRY IM TIMED!!!

Biology
1 answer:
Zanzabum1 year ago
5 0

Answer:

D.  more, faster

Explanation:

The more surface area exposed the faster the weathering occurs.

You might be interested in
The section of the cell membrane illustrates one method of cellular transport. Consider steps A, B and C. What transport mechani
andrezito [222]
The model attached represents facilitated transport, which is answer choice D. In the model, there are protein channels, which allow molecules to pass through them if they're too large to fit through the aquaporins (making diffusion an incorrect answer.) We can eliminate active transport since ATP isn't used to control transport, and we can eliminate endocytosis as it is a form of active transport. The remaining answer would be facilitated transport, which is a form of passive transport. Hope this helps! :)
3 0
3 years ago
Which process must occur before mitosis and meiosis can occur?​
STALIN [3.7K]

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

                  Hello!

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

❖ Before mitosis and meiosis occur, DNA replication has to occur. DNA replication is when another copy is made of the DNA and in mitosis and meiosis, you need the replicated DNA for the sister chromatids.

~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡

~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ

4 0
2 years ago
Ferns use the starch-filled cells of this structure for storage.
Jlenok [28]
The vacuole i believe is the answer
5 0
3 years ago
Is this a lunar eclipse or solar eclipse?
viktelen [127]

Answer:

I believe C

Explanation:

7 0
3 years ago
Read 2 more answers
In terms of ATP, how much more energy does the aerobic respiration process produce?
andrew-mc [135]

Answer:

Aerobic respiration process produce either 36 ATP or 38 ATP depending on the amount of NADH moles while Anaerobic produces 2 ATP. Aerobic respiration produces 32-34 ATP more

Explanation:

Aerobic respiration has 3 steps which includes; Glycolysis which produces 2ATP; Krebs cycle which produces 2 ATP and Electron Transport Chain which produces 32 - 34 ATP depending on the molecule of NADH introduced into the reaction from the kreb cycle

8 0
3 years ago
Other questions:
  • Match each statement below to the correct scientist.
    13·1 answer
  • A cell is viewed under a microscope and is found to have two nuclear envelopes and spindles that appear to be breaking apart. Wh
    14·1 answer
  • Which organelle carries substances to other parts of the cell?
    15·1 answer
  • Provide three reasons why the use of aseptic technique is essential when handling microbial cultures
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • A ratio used as a scale on a map is called a?
    12·1 answer
  • The Cell TheoryThe smallest living things are one-celled or ____+_______________Large organisms contain millions of cells. They
    7·1 answer
  • The difference between the human nervous system and the endocrine system is that
    13·1 answer
  • How do the functions of the osteoclasts and osteoblasts differ?.
    14·1 answer
  • Most of the joints in the appendicular skeleton are __________ joints.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!