1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Molodets [167]
2 years ago
7

Which part of the plasma membrane helps cells recognize each other as

Biology
1 answer:
natka813 [3]2 years ago
6 0

Answer:

Phospholipid Bilayer

Explanation:

i helped my friend with her test and that was the answer

You might be interested in
What part of a plant stores water and glucose?​
Bogdan [553]

Answer:

Too be specific a Plant Cell stores water for health ans glucose (aka) sugar for energy, which is called Vacuole

8 0
3 years ago
Which is heavier, dry air or moist air? Why?<br><br> WILL MARK BRAINLIEST!!
jeka57 [31]

Explanation:

Moist Air Is Heavier As Moist Air Has Water Content In It.

Please Mark As Brainliest..

4 0
3 years ago
What kind of living and nonliving things do you think a marine biologist studies ?
prisoha [69]
Marine biologists study changes in the ocean. so they will look at the chemical composition of deep waters and see how consecrated the oxygen is. They will also study the movements of the plates because when planted move it usually makes new food for deep life

they will also check animal concentrations in certain areas.

Another thing they do is track animal movements. this could be by putting a tracker on a whale or a shark or anything and watching its depths it goes or watching the distance it goes in a day.
6 0
3 years ago
Read 2 more answers
The buccinator muscle __________. The buccinator muscle __________. purses the lips raises the corners of the mouth compresses t
Anuta_ua [19.1K]

Answer:

compresses the cheeks

5 0
4 years ago
Under most weathering conditions, which mineral component of granites and rhyolites would be most resistant to decomposition?
lions [1.4K]
Granite would be more resistant to decomposition as compared to rhyolite because <span><span>rhyolite is a fine-grained rock and Granite is a coarse-grained rock. 

</span>Granite tends to be more stable to weathering conditions. The major component of </span><span>quartz, orthoclase, muscovite and biotite are the in order of resistant to decomposition.</span>
8 0
3 years ago
Other questions:
  • people once believed organisms could grow from food ordered how might the scientific study of cells have affected this view
    9·1 answer
  • List the four organ systems which are operational in a amoeba
    10·2 answers
  • You notice that some squirrels in your neighborhood have a much darker coat color than most of the other squirrels. is this dark
    15·1 answer
  • A plant has two organ systems: the shoot system and the root system.
    10·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Arrange the sentences in order to describe how oxygen from air is transported to the cells in the kidneys.
    15·1 answer
  • A plant cell remains unchanged in shape or size when it is kept in a solution. What kind of solution is it?
    13·2 answers
  • What kind of rock is it this? Sedimentary, Igneous, or Metamorphic?
    8·2 answers
  • in ______ transport materials move from an area of higher consideration to an area of lower consideration through a small membra
    10·2 answers
  • BEAKER 4
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!