Question

Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Answer 1

In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

What are restriction enzymes?

Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).

These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.

In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

Learn more about restriction enzymes here:

brainly.com/question/15278286

#SPJ1