During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
its a thousand of generation evolution i think as of darwins law of evolution
Answer:
All the matter to ever exist was created in the big bang. The amount of space between clumps of matter is increasing, which is allowing the expansion of the universe. There are plenty of conditions for the every matters being created.
The reason why the animal that has been struck by the arrow
goes limp and quickly suffocates because the acetylcholine receptor sites are
blocked and this was made possible because of the drug curare they use in
poisoning the top of the arrows.
