Answer:
Gravity is the force of attraction between two objects, and Earth's gravity pulls matter downward, toward its center. It pulls precipitation down from clouds and pulls water downhill. The warm water near the surface of the ocean heats up with sunlight and evaporates, keeping the water cycle in motion.
Explanation:
C) The urine amount will be decreased because your body needs to preserve that water and keep it in your body and bloodstream.
Type two is where their are to much insulin but not enough glucose that's all I can say sorry
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The answer to the question is enzyme linked receptor.
