1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
2 years ago
12

Write the issues of digestive health mention briefly ​

Biology
1 answer:
lawyer [7]2 years ago
4 0
Some common issues of digestive health include heartburn, cancer, irritable bowel syndrome, and lactose intolerance.
You might be interested in
Roan cattle are the heterozygous hybrids of a cross between a white bull and a red cow. If a roan bull were crossed with a red c
horrorfan [7]
Half roan and half red
7 0
3 years ago
Which of these is the best description of a typical organism in the plant kingdom?
Studentka2010 [4]
Idk, who cares anyways
8 0
3 years ago
A student exposed to streptococcus comes down with a high fever. What is the likely cause?
LuckyWell [14K]
The answer would be B.. :) 
6 0
3 years ago
Read 2 more answers
The photograph shows wild salmon. What makes wild salmon a renewable<br> resource?
AleksandrR [38]

The wild salmon has the capability of reproducing quickly, which makes wild salmon a renewable resource.

<h3>What do you mean by Renewable resources?</h3>

Renewable resources may be defined as those resources that are not exhausted and deliver endless energy.

Wild salmon can be taken as one of the chief sources of food that provides energy. This form of energy may lead to renewable energy because it is endless, as the reproduction rate of wild salmon is fast with  large clutch size.  

Therefore, the wild salmon has the capability of reproducing quickly, which makes wild salmon a renewable resource.

To learn more about Renewable resources, refer to the link:

brainly.com/question/79953

#SPJ1

5 0
2 years ago
Discuss the theories of opening and closing stomata​
Anestetic [448]

Guard cell o is ordered to opening and closing of stomata.

3 0
3 years ago
Other questions:
  • Give an example of how structure is related to function in living things
    8·1 answer
  • What does the contractile vacuole in a Paramecium do and why? PLEASE HELP!!
    10·2 answers
  • Zane has been feeling low for the past month or so. he has little energy and difficulty concentrating. he has gained nearly 10 p
    12·2 answers
  • Most of Earth's active volcanoes on land are located
    14·1 answer
  • Waters high heat capacity protects organisms in the ocean from what?
    13·1 answer
  • Predict what will happen to the model of the cell in this experiment
    11·1 answer
  • What happens to blood at the lungs and why is it important to homeostasis?
    9·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Chemical reactions can occur in the cells of living things.
    15·1 answer
  • In boiling water water molecules move apart and a scoop in the form of water vapor the process is called
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!