1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solong [7]
2 years ago
15

Arboreal animals are animals that _______.

Biology
2 answers:
NemiM [27]2 years ago
6 0

Answer:

The correct answer is option b, that is, live in trees.

Explanation:

The arboreal animals refer to the animals that devote the majority of their lives in trees. This animal group eat, play, and sleep in the canopy of the tree. Some of the examples of arboreal animals are tree snakes, monkeys, koalas, parrot sloths, possums, and various rodents.  

These animals exhibit unique adaptations like long feet and claws, long tails and elongated limbs, and unique movement patterns, which help them to thrive in their arboreal lifestyles.  

Anarel [89]2 years ago
4 0
B. Live in Trees

Animals such as Squirrels are Arboreal.  <span />
You might be interested in
In at least 100 words, construct an explanation that predict an organism's ability to
Elodia [21]

Answer:

An organism is able to produce sweat so that it cools off which helps it to cool down when exposed to high temperatures.

It's vessels are able to vasodilate and vasoconstrict to regulate temperature.

An organism stores fat as an insulator.

Eye pupils dilate and constrict to control the amount of light entering the eye.

If an organism touches a hot surface, nerve impulses are sent to the body to move and not get injured.

In a nutshell: an organism maintain a constant internal environment with homeostasis. And is able to respond to changes in the atmosphere by electrical impulses (nervous system) or the endocrine system by the release of chemicals (called hormones)

3 0
2 years ago
If 5% of a DNA sample is made up of thymine, C, what percentage of the sample is made up of cytosine, A?
zalisa [80]

Answer:

95%

Explanation:

7 0
2 years ago
How does the digestive system work at the tissue level? Will give brainiest.
Alika [10]
The digestive system contains all four major tissue types, epithelial<span>, connective, muscle and nervous. e</span>pithelial<span> tissue lines the entire length the digestive tract. it is made up of many different types of cells, including goblet cells that secrete mucus.</span>
3 0
3 years ago
Provide evidence to reject this statement, "Human phenotypes are usually a clear cut either situation"
tensa zangetsu [6.8K]
Wavy hair is a very easy example that this is false.  It's a merge between straight and curly hair.  Our traits tend to mix and blend together, it's not so simple.  Everybody isn't just tall or short, one or the other.  Everybody is a different height because it's a mid between your parents. 
8 0
3 years ago
Read 2 more answers
During hot weather and vigorous exercise people sweat. as the water on their skin evaporate the water molecules absorb heat ener
Vedmedyk [2.9K]
The heat to evaporate the water in the sweat comes from the skin and provides a cooling effect. The body then does not overheat. hope it help
4 0
2 years ago
Read 2 more answers
Other questions:
  • Fossils are related to evolution justify this statement
    15·1 answer
  • Which is the largest artery in the body?
    9·2 answers
  • (04.03 HC) Salvatore had grown tired of his fish tank and would like to get rid of the fish and contents of the tank in a nearby
    15·2 answers
  • All of the following are benthic organisms except ________.
    9·2 answers
  • The Shine-Dalgarno sequence in bacteria ________.
    5·1 answer
  • If carbon dioxide is completely removed from a plant’s environment, what would you expect to happen to the plant’s production of
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What is the role of phagocytes in this stage of the wound healing process
    12·1 answer
  • What carries messages away from the cell body
    5·1 answer
  • Describe polarity in your own words.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!