1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dovator [93]
1 year ago
14

1 2 3 or 4 pls I’m not sure

Biology
1 answer:
Hitman42 [59]1 year ago
3 0

Answer:

the answer of this question in my opinion is 3

You might be interested in
How many planets are in the solar system?
gladu [14]

eight hope this helps.

5 0
3 years ago
Read 2 more answers
This developing plant uses starch stored in the seed as a source of energy during germination. This stored starch is a by-produc
dimulka [17.4K]
The answer is photosynthesis.Photosynthesis occurs in the leaves of green plants. During photosynthesis, carbon dioxide and water are converted into glucose and oxygen using the energy of sunlight. The excess of glucose synthesized in photosynthesis is converted and stored as a starch.
7 0
3 years ago
Read 2 more answers
Predict what might happen if the human body did not have specialized cells, tissues, organs, and organ systems to maintain homeo
netineya [11]
The kneegrows woul d take over
3 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Which characterization accurately describes BOTH regular fossils and index fossils?
kompoz [17]

Answer:

D

Explanation:

Fossils tell us where they came from.

Have a great day

7 0
3 years ago
Other questions:
  • HELP Which situation would not encourage competition? Select one:
    11·2 answers
  • Life is the topic of this course. Write an essay about the characteristics of life discussed in Section 1 of this unit. Your ess
    9·1 answer
  • What are some examples of fungi
    15·1 answer
  • At what stage in C. elegans does cell differentiation occur?
    13·2 answers
  • In which location are you most likely to find an earthworm?
    11·1 answer
  • Classify the characteristics by whether they describe plants only, fungi only, or both plants and fungi
    11·2 answers
  • At a hypothetical locus, a man’s genotype is Aa. What proportion of his gametes would be expectedto receive the A allele?a.1/3b.
    11·1 answer
  • The chemical reactions of the light dependent process occur in the
    10·1 answer
  • Which term best describes a pure substance that is made up of only one type of atom
    12·1 answer
  • If you pressed a stethoscope diaphragm firmly on a volunteer's skin at the following locations on the right side of the body: In
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!